FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641047_at:

>probe:Drosophila_2:1641047_at:638:85; Interrogation_Position=3753; Antisense; AGTCCAGTTGTGAGTCCAACAGCTT
>probe:Drosophila_2:1641047_at:414:87; Interrogation_Position=3765; Antisense; AGTCCAACAGCTTGGCCGCCAGTTG
>probe:Drosophila_2:1641047_at:633:93; Interrogation_Position=3785; Antisense; AGTTGCGGCGATGTCTGCCAGGTCA
>probe:Drosophila_2:1641047_at:386:59; Interrogation_Position=3795; Antisense; ATGTCTGCCAGGTCAGCAGTAAGCT
>probe:Drosophila_2:1641047_at:203:493; Interrogation_Position=3813; Antisense; GTAAGCTGGCAAATGACGCCTCATT
>probe:Drosophila_2:1641047_at:527:167; Interrogation_Position=3823; Antisense; AAATGACGCCTCATTACCATCTACT
>probe:Drosophila_2:1641047_at:531:413; Interrogation_Position=3860; Antisense; GACCATGCCAGCACCTAGAGATTTT
>probe:Drosophila_2:1641047_at:326:339; Interrogation_Position=3977; Antisense; GCTACAATGGTAGGGCGGACAACAA
>probe:Drosophila_2:1641047_at:370:81; Interrogation_Position=4081; Antisense; AGTCATACGATTACACCGACCGATG
>probe:Drosophila_2:1641047_at:603:707; Interrogation_Position=4091; Antisense; TTACACCGACCGATGAGCTGATCAA
>probe:Drosophila_2:1641047_at:583:427; Interrogation_Position=4142; Antisense; GAGATCTATTCACAGCTGGATTCTA
>probe:Drosophila_2:1641047_at:92:121; Interrogation_Position=4155; Antisense; AGCTGGATTCTATCGCTGAGGTATC
>probe:Drosophila_2:1641047_at:685:43; Interrogation_Position=4166; Antisense; ATCGCTGAGGTATCATCACGTCAAT
>probe:Drosophila_2:1641047_at:189:715; Interrogation_Position=4216; Antisense; TTGTGATTTCATTACTTAACGAGTT

Paste this into a BLAST search page for me
AGTCCAGTTGTGAGTCCAACAGCTTAGTCCAACAGCTTGGCCGCCAGTTGAGTTGCGGCGATGTCTGCCAGGTCAATGTCTGCCAGGTCAGCAGTAAGCTGTAAGCTGGCAAATGACGCCTCATTAAATGACGCCTCATTACCATCTACTGACCATGCCAGCACCTAGAGATTTTGCTACAATGGTAGGGCGGACAACAAAGTCATACGATTACACCGACCGATGTTACACCGACCGATGAGCTGATCAAGAGATCTATTCACAGCTGGATTCTAAGCTGGATTCTATCGCTGAGGTATCATCGCTGAGGTATCATCACGTCAATTTGTGATTTCATTACTTAACGAGTT

Full Affymetrix probeset data:

Annotations for 1641047_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720