FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641049_at:

>probe:Drosophila_2:1641049_at:139:173; Interrogation_Position=189; Antisense; AAAGAAGCTGTTCGTGCAGCGCTGC
>probe:Drosophila_2:1641049_at:47:133; Interrogation_Position=226; Antisense; ACCGTTGAGGCTGGTGGCAAGCACA
>probe:Drosophila_2:1641049_at:309:357; Interrogation_Position=246; Antisense; GCACAAGGTTGGACCCAATCTGCAT
>probe:Drosophila_2:1641049_at:109:239; Interrogation_Position=262; Antisense; AATCTGCATGGTCTGATCGGTCGCA
>probe:Drosophila_2:1641049_at:488:399; Interrogation_Position=293; Antisense; GACAGGCGGCCGGATTCGCGTACAC
>probe:Drosophila_2:1641049_at:371:221; Interrogation_Position=334; Antisense; AAGGGCATCACCTGGAACGAGGACA
>probe:Drosophila_2:1641049_at:241:399; Interrogation_Position=355; Antisense; GACACCCTGTTCGAGTACCTGGAGA
>probe:Drosophila_2:1641049_at:199:423; Interrogation_Position=376; Antisense; GAGAACCCCAAGAAGTACATCCCCG
>probe:Drosophila_2:1641049_at:30:129; Interrogation_Position=403; Antisense; ACCAAGATGATCTTCGCCGGTCTGA
>probe:Drosophila_2:1641049_at:42:299; Interrogation_Position=417; Antisense; CGCCGGTCTGAAGAAGCCCAACGAG
>probe:Drosophila_2:1641049_at:80:453; Interrogation_Position=448; Antisense; GATCTGATCGCCTACCTGAAGTCGG
>probe:Drosophila_2:1641049_at:406:493; Interrogation_Position=480; Antisense; GTAATGGTGCTGTCCATCAACTTAC
>probe:Drosophila_2:1641049_at:476:703; Interrogation_Position=501; Antisense; TTACCCACAACCACTGCAGGATGTC
>probe:Drosophila_2:1641049_at:137:689; Interrogation_Position=535; Antisense; TATTGTGTTCAGTCACAGTCCGGCA

Paste this into a BLAST search page for me
AAAGAAGCTGTTCGTGCAGCGCTGCACCGTTGAGGCTGGTGGCAAGCACAGCACAAGGTTGGACCCAATCTGCATAATCTGCATGGTCTGATCGGTCGCAGACAGGCGGCCGGATTCGCGTACACAAGGGCATCACCTGGAACGAGGACAGACACCCTGTTCGAGTACCTGGAGAGAGAACCCCAAGAAGTACATCCCCGACCAAGATGATCTTCGCCGGTCTGACGCCGGTCTGAAGAAGCCCAACGAGGATCTGATCGCCTACCTGAAGTCGGGTAATGGTGCTGTCCATCAACTTACTTACCCACAACCACTGCAGGATGTCTATTGTGTTCAGTCACAGTCCGGCA

Full Affymetrix probeset data:

Annotations for 1641049_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720