Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641050_s_at:

>probe:Drosophila_2:1641050_s_at:252:609; Interrogation_Position=110; Antisense; TGACGCCCACCGAACAGGAAGCAGT
>probe:Drosophila_2:1641050_s_at:58:391; Interrogation_Position=135; Antisense; GAAACGCTTCTGGAGGTCGCTGGTT
>probe:Drosophila_2:1641050_s_at:722:429; Interrogation_Position=15; Antisense; GAGTGTTCGCCCCAATAACGCTGGC
>probe:Drosophila_2:1641050_s_at:187:579; Interrogation_Position=155; Antisense; TGGTTTTGCGAAGTCAACGCGCCTT
>probe:Drosophila_2:1641050_s_at:172:495; Interrogation_Position=167; Antisense; GTCAACGCGCCTTCATTGAGGAAAA
>probe:Drosophila_2:1641050_s_at:87:115; Interrogation_Position=266; Antisense; AGCAGCTTTGGCCACAAGATCGGAT
>probe:Drosophila_2:1641050_s_at:675:41; Interrogation_Position=284; Antisense; ATCGGATGTGGGTCAACCTGACGCC
>probe:Drosophila_2:1641050_s_at:126:661; Interrogation_Position=30; Antisense; TAACGCTGGCGATATGTTGCTCCAC
>probe:Drosophila_2:1641050_s_at:270:611; Interrogation_Position=302; Antisense; TGACGCCCGCACAGAAATGCAGCGA
>probe:Drosophila_2:1641050_s_at:183:167; Interrogation_Position=316; Antisense; AAATGCAGCGAGTCGGGCCAACCAA
>probe:Drosophila_2:1641050_s_at:79:663; Interrogation_Position=366; Antisense; TAACAATACACTTAACTTGGCCGAA
>probe:Drosophila_2:1641050_s_at:487:167; Interrogation_Position=390; Antisense; AAAGGCAAATTTGTCACAGCGGCGC
>probe:Drosophila_2:1641050_s_at:397:457; Interrogation_Position=40; Antisense; GATATGTTGCTCCACAATTCCGTAA
>probe:Drosophila_2:1641050_s_at:446:693; Interrogation_Position=88; Antisense; TTTGCCGAAAAGATAACCCACCTGA

Paste this into a BLAST search page for me
TGACGCCCACCGAACAGGAAGCAGTGAAACGCTTCTGGAGGTCGCTGGTTGAGTGTTCGCCCCAATAACGCTGGCTGGTTTTGCGAAGTCAACGCGCCTTGTCAACGCGCCTTCATTGAGGAAAAAGCAGCTTTGGCCACAAGATCGGATATCGGATGTGGGTCAACCTGACGCCTAACGCTGGCGATATGTTGCTCCACTGACGCCCGCACAGAAATGCAGCGAAAATGCAGCGAGTCGGGCCAACCAATAACAATACACTTAACTTGGCCGAAAAAGGCAAATTTGTCACAGCGGCGCGATATGTTGCTCCACAATTCCGTAATTTGCCGAAAAGATAACCCACCTGA

Full Affymetrix probeset data:

Annotations for 1641050_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime