FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641052_at:

>probe:Drosophila_2:1641052_at:615:715; Interrogation_Position=216; Antisense; TTCGATCATCGCACACGATTGGGTG
>probe:Drosophila_2:1641052_at:618:157; Interrogation_Position=228; Antisense; ACACGATTGGGTGCTCACCGCCGAG
>probe:Drosophila_2:1641052_at:410:427; Interrogation_Position=263; Antisense; GAGATGCTGACTCCGTAACTGTCTA
>probe:Drosophila_2:1641052_at:249:605; Interrogation_Position=270; Antisense; TGACTCCGTAACTGTCTACTTCGGA
>probe:Drosophila_2:1641052_at:416:539; Interrogation_Position=330; Antisense; GGTTGGCAACGGTAACTTTATCAAG
>probe:Drosophila_2:1641052_at:23:699; Interrogation_Position=346; Antisense; TTTATCAAGCACTCATCCGCCGATA
>probe:Drosophila_2:1641052_at:552:159; Interrogation_Position=554; Antisense; ACAACTCCGAGTGCTCCGGATACTA
>probe:Drosophila_2:1641052_at:484:85; Interrogation_Position=563; Antisense; AGTGCTCCGGATACTATGGAAGCGT
>probe:Drosophila_2:1641052_at:475:205; Interrogation_Position=582; Antisense; AAGCGTGGGAGACAACATCCTCTGT
>probe:Drosophila_2:1641052_at:583:423; Interrogation_Position=590; Antisense; GAGACAACATCCTCTGTGTCAGGAC
>probe:Drosophila_2:1641052_at:449:593; Interrogation_Position=604; Antisense; TGTGTCAGGACTCCCGACGGCAAGT
>probe:Drosophila_2:1641052_at:203:309; Interrogation_Position=695; Antisense; CCAACTTTGGTTCCGTCGCCGGCTG
>probe:Drosophila_2:1641052_at:472:669; Interrogation_Position=757; Antisense; TACCACCTGGACTGGATTCGCGACC
>probe:Drosophila_2:1641052_at:359:719; Interrogation_Position=773; Antisense; TTCGCGACCATACCGGCATTGCTTA

Paste this into a BLAST search page for me
TTCGATCATCGCACACGATTGGGTGACACGATTGGGTGCTCACCGCCGAGGAGATGCTGACTCCGTAACTGTCTATGACTCCGTAACTGTCTACTTCGGAGGTTGGCAACGGTAACTTTATCAAGTTTATCAAGCACTCATCCGCCGATAACAACTCCGAGTGCTCCGGATACTAAGTGCTCCGGATACTATGGAAGCGTAAGCGTGGGAGACAACATCCTCTGTGAGACAACATCCTCTGTGTCAGGACTGTGTCAGGACTCCCGACGGCAAGTCCAACTTTGGTTCCGTCGCCGGCTGTACCACCTGGACTGGATTCGCGACCTTCGCGACCATACCGGCATTGCTTA

Full Affymetrix probeset data:

Annotations for 1641052_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720