FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641055_at:

>probe:Drosophila_2:1641055_at:266:711; Interrogation_Position=364; Antisense; TTCAAGCCCAGCGAACTGGTGGTCA
>probe:Drosophila_2:1641055_at:711:537; Interrogation_Position=384; Antisense; GGTCAAAGTGCAGGACAACTCCGTC
>probe:Drosophila_2:1641055_at:256:99; Interrogation_Position=438; Antisense; AGATGACCATGGCTTCATCACTCGT
>probe:Drosophila_2:1641055_at:241:683; Interrogation_Position=478; Antisense; TATGCTCTGCCACCCGGTTATGAGG
>probe:Drosophila_2:1641055_at:198:65; Interrogation_Position=533; Antisense; ATGGTGTCCTGACCATCAAGGTGCC
>probe:Drosophila_2:1641055_at:598:253; Interrogation_Position=558; Antisense; CAAGCCACCGGCAATCGAGGATAAG
>probe:Drosophila_2:1641055_at:466:417; Interrogation_Position=589; Antisense; GAGCGCATCGTTCAGATCCAGCAGG
>probe:Drosophila_2:1641055_at:452:411; Interrogation_Position=617; Antisense; GACCCGCCCATCTCAATGTGAAGGA
>probe:Drosophila_2:1641055_at:405:405; Interrogation_Position=690; Antisense; GACTCGTTCCGAGAGATGCCCTGCA
>probe:Drosophila_2:1641055_at:671:447; Interrogation_Position=704; Antisense; GATGCCCTGCATTATTTAACCATTA
>probe:Drosophila_2:1641055_at:579:659; Interrogation_Position=751; Antisense; TAAGCTGTAGTTATCCAAGGACACT
>probe:Drosophila_2:1641055_at:502:251; Interrogation_Position=766; Antisense; CAAGGACACTTCACTCATACACAAT
>probe:Drosophila_2:1641055_at:524:161; Interrogation_Position=786; Antisense; ACAATAGCCATTAAGGGTGTCCTGC
>probe:Drosophila_2:1641055_at:578:531; Interrogation_Position=800; Antisense; GGGTGTCCTGCTTTAATCTTAGTTT

Paste this into a BLAST search page for me
TTCAAGCCCAGCGAACTGGTGGTCAGGTCAAAGTGCAGGACAACTCCGTCAGATGACCATGGCTTCATCACTCGTTATGCTCTGCCACCCGGTTATGAGGATGGTGTCCTGACCATCAAGGTGCCCAAGCCACCGGCAATCGAGGATAAGGAGCGCATCGTTCAGATCCAGCAGGGACCCGCCCATCTCAATGTGAAGGAGACTCGTTCCGAGAGATGCCCTGCAGATGCCCTGCATTATTTAACCATTATAAGCTGTAGTTATCCAAGGACACTCAAGGACACTTCACTCATACACAATACAATAGCCATTAAGGGTGTCCTGCGGGTGTCCTGCTTTAATCTTAGTTT

Full Affymetrix probeset data:

Annotations for 1641055_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720