FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641058_at:

>probe:Drosophila_2:1641058_at:313:709; Interrogation_Position=296; Antisense; TTAACATAACCTTCGTGCGTGCCAA
>probe:Drosophila_2:1641058_at:639:183; Interrogation_Position=345; Antisense; AAAAGTGGGTGACTCCCTGCTGGAC
>probe:Drosophila_2:1641058_at:505:605; Interrogation_Position=446; Antisense; TGATCTTCAAGACCAGCGATTTCGA
>probe:Drosophila_2:1641058_at:86:327; Interrogation_Position=461; Antisense; GCGATTTCGAGAAACTGCCCGACAA
>probe:Drosophila_2:1641058_at:274:175; Interrogation_Position=484; Antisense; AAACCCGGTGATGAGGAGCTGGACA
>probe:Drosophila_2:1641058_at:97:333; Interrogation_Position=501; Antisense; GCTGGACATGCTGGATTTGGCGTAC
>probe:Drosophila_2:1641058_at:426:725; Interrogation_Position=517; Antisense; TTGGCGTACGAACTGACGGACACCT
>probe:Drosophila_2:1641058_at:126:265; Interrogation_Position=556; Antisense; CAGATCACCCTGTCCAAGGATATGG
>probe:Drosophila_2:1641058_at:67:233; Interrogation_Position=613; Antisense; AATGACGCACGTGCCGCGTAGATAG
>probe:Drosophila_2:1641058_at:640:327; Interrogation_Position=628; Antisense; GCGTAGATAGACACCACCACTGTTA
>probe:Drosophila_2:1641058_at:691:165; Interrogation_Position=721; Antisense; AAATCGTATGTATTGTCCCAGGGAC
>probe:Drosophila_2:1641058_at:637:527; Interrogation_Position=741; Antisense; GGGACACAAACCTCAGGCGGCTATA
>probe:Drosophila_2:1641058_at:431:447; Interrogation_Position=769; Antisense; GATGCGCGCATTAATCCGATTCCAG
>probe:Drosophila_2:1641058_at:234:705; Interrogation_Position=801; Antisense; TTAGCGTCCGCTGTTGTTTTTAAAG

Paste this into a BLAST search page for me
TTAACATAACCTTCGTGCGTGCCAAAAAAGTGGGTGACTCCCTGCTGGACTGATCTTCAAGACCAGCGATTTCGAGCGATTTCGAGAAACTGCCCGACAAAAACCCGGTGATGAGGAGCTGGACAGCTGGACATGCTGGATTTGGCGTACTTGGCGTACGAACTGACGGACACCTCAGATCACCCTGTCCAAGGATATGGAATGACGCACGTGCCGCGTAGATAGGCGTAGATAGACACCACCACTGTTAAAATCGTATGTATTGTCCCAGGGACGGGACACAAACCTCAGGCGGCTATAGATGCGCGCATTAATCCGATTCCAGTTAGCGTCCGCTGTTGTTTTTAAAG

Full Affymetrix probeset data:

Annotations for 1641058_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720