FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641062_at:

>probe:Drosophila_2:1641062_at:222:313; Interrogation_Position=1587; Antisense; GCCACCTCAGATAGCGCACAACAAA
>probe:Drosophila_2:1641062_at:444:401; Interrogation_Position=1623; Antisense; GACTCTTAGCTTGTAATTATTCCGG
>probe:Drosophila_2:1641062_at:464:653; Interrogation_Position=1648; Antisense; TAATCTCCCCAAACCTTAGGCTTAG
>probe:Drosophila_2:1641062_at:20:175; Interrogation_Position=1675; Antisense; AAACATTTGTCCACCATTTCACCCA
>probe:Drosophila_2:1641062_at:501:231; Interrogation_Position=1734; Antisense; AATGATTTATACATCGTCCTATGAA
>probe:Drosophila_2:1641062_at:351:123; Interrogation_Position=1811; Antisense; AGCGAGATTCCTATTGTATGCAATT
>probe:Drosophila_2:1641062_at:434:483; Interrogation_Position=1927; Antisense; GTATCTATTTGTAGCACATTGCCAT
>probe:Drosophila_2:1641062_at:52:211; Interrogation_Position=1953; Antisense; AAGAATTTGCGTTGACCTTCAGAAG
>probe:Drosophila_2:1641062_at:473:167; Interrogation_Position=2007; Antisense; AAATGTGCCCACGTCTAATCAAGCC
>probe:Drosophila_2:1641062_at:200:205; Interrogation_Position=2027; Antisense; AAGCCATGCCATGAAATCACCGGAA
>probe:Drosophila_2:1641062_at:86:35; Interrogation_Position=2042; Antisense; ATCACCGGAAGACTCTTTTTAATGG
>probe:Drosophila_2:1641062_at:492:637; Interrogation_Position=2079; Antisense; TCGAGAGCATTGTTTTGCGCACAGT
>probe:Drosophila_2:1641062_at:120:325; Interrogation_Position=2095; Antisense; GCGCACAGTGGGTTGAATGCTTACA
>probe:Drosophila_2:1641062_at:232:241; Interrogation_Position=2127; Antisense; AATTTCGCTGTAATACTTTCTTAGA

Paste this into a BLAST search page for me
GCCACCTCAGATAGCGCACAACAAAGACTCTTAGCTTGTAATTATTCCGGTAATCTCCCCAAACCTTAGGCTTAGAAACATTTGTCCACCATTTCACCCAAATGATTTATACATCGTCCTATGAAAGCGAGATTCCTATTGTATGCAATTGTATCTATTTGTAGCACATTGCCATAAGAATTTGCGTTGACCTTCAGAAGAAATGTGCCCACGTCTAATCAAGCCAAGCCATGCCATGAAATCACCGGAAATCACCGGAAGACTCTTTTTAATGGTCGAGAGCATTGTTTTGCGCACAGTGCGCACAGTGGGTTGAATGCTTACAAATTTCGCTGTAATACTTTCTTAGA

Full Affymetrix probeset data:

Annotations for 1641062_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720