FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641064_at:

>probe:Drosophila_2:1641064_at:541:711; Interrogation_Position=119; Antisense; TTCTTTTTGCTATTGGCTTTGGCCC
>probe:Drosophila_2:1641064_at:287:275; Interrogation_Position=143; Antisense; CTTGTGGGCATTGCTGCTGGAGCTC
>probe:Drosophila_2:1641064_at:298:267; Interrogation_Position=188; Antisense; CAGGGACCCAATCCTCAGGATATTG
>probe:Drosophila_2:1641064_at:68:303; Interrogation_Position=217; Antisense; CCCGGAGCCGGAGTACATTGATATC
>probe:Drosophila_2:1641064_at:402:723; Interrogation_Position=234; Antisense; TTGATATCGACGAACCTGCACCGGT
>probe:Drosophila_2:1641064_at:180:589; Interrogation_Position=363; Antisense; TGGTTGTGGCCCAATCCTTCGTCCA
>probe:Drosophila_2:1641064_at:704:291; Interrogation_Position=394; Antisense; CGTCCAGCAGCAGATTGTCCAGAGG
>probe:Drosophila_2:1641064_at:382:629; Interrogation_Position=411; Antisense; TCCAGAGGGCTCAGTACGTGGCGCC
>probe:Drosophila_2:1641064_at:379:649; Interrogation_Position=442; Antisense; TCAGCAGGTGGTGTTGCCGCAACAG
>probe:Drosophila_2:1641064_at:582:187; Interrogation_Position=462; Antisense; AACAGCAGCTGGTGGGACACACCTA
>probe:Drosophila_2:1641064_at:716:397; Interrogation_Position=477; Antisense; GACACACCTACAACAGCAGGGCTGG
>probe:Drosophila_2:1641064_at:640:81; Interrogation_Position=494; Antisense; AGGGCTGGATACCAGTACCGCCGTC
>probe:Drosophila_2:1641064_at:5:673; Interrogation_Position=509; Antisense; TACCGCCGTCCAGTCTATAACGAAA
>probe:Drosophila_2:1641064_at:603:647; Interrogation_Position=640; Antisense; TCAGTTATTGTTGAATTGCCCAGTA

Paste this into a BLAST search page for me
TTCTTTTTGCTATTGGCTTTGGCCCCTTGTGGGCATTGCTGCTGGAGCTCCAGGGACCCAATCCTCAGGATATTGCCCGGAGCCGGAGTACATTGATATCTTGATATCGACGAACCTGCACCGGTTGGTTGTGGCCCAATCCTTCGTCCACGTCCAGCAGCAGATTGTCCAGAGGTCCAGAGGGCTCAGTACGTGGCGCCTCAGCAGGTGGTGTTGCCGCAACAGAACAGCAGCTGGTGGGACACACCTAGACACACCTACAACAGCAGGGCTGGAGGGCTGGATACCAGTACCGCCGTCTACCGCCGTCCAGTCTATAACGAAATCAGTTATTGTTGAATTGCCCAGTA

Full Affymetrix probeset data:

Annotations for 1641064_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720