Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641065_s_at:

>probe:Drosophila_2:1641065_s_at:717:85; Interrogation_Position=251; Antisense; AGTGCATCCTGAAGCGCAACACGGA
>probe:Drosophila_2:1641065_s_at:274:187; Interrogation_Position=268; Antisense; AACACGGAGGCCAGCATTCAGATGA
>probe:Drosophila_2:1641065_s_at:315:11; Interrogation_Position=283; Antisense; ATTCAGATGAAGATCCGGCCGGAGC
>probe:Drosophila_2:1641065_s_at:52:611; Interrogation_Position=323; Antisense; TGACCTCCGACATCCAGGGCATTAT
>probe:Drosophila_2:1641065_s_at:309:471; Interrogation_Position=366; Antisense; GTTCCCAGGATATTACGGCACCAGC
>probe:Drosophila_2:1641065_s_at:209:599; Interrogation_Position=394; Antisense; TGTCCGCACATCTACGACGAGGCTG
>probe:Drosophila_2:1641065_s_at:615:613; Interrogation_Position=443; Antisense; TGAAGGCCGGCCAGGTGTACACCTA
>probe:Drosophila_2:1641065_s_at:496:211; Interrogation_Position=469; Antisense; AAGAACAGCTTCAAGATCCTGCCCG
>probe:Drosophila_2:1641065_s_at:602:671; Interrogation_Position=496; Antisense; TACCCGACCGTCAGTTTGGAGATCC
>probe:Drosophila_2:1641065_s_at:663:557; Interrogation_Position=600; Antisense; GGACAAGTGCACTCAATGTTAGCTT
>probe:Drosophila_2:1641065_s_at:481:451; Interrogation_Position=645; Antisense; GATCGTATCTGCGTATCTGCATATG
>probe:Drosophila_2:1641065_s_at:391:115; Interrogation_Position=711; Antisense; AGCAGGCCATTATTGCGGCATCCAG
>probe:Drosophila_2:1641065_s_at:97:567; Interrogation_Position=727; Antisense; GGCATCCAGCCAGTGACGCAATATG
>probe:Drosophila_2:1641065_s_at:376:257; Interrogation_Position=754; Antisense; CAAAGGATTCCACTGATCGGCTCAG

Paste this into a BLAST search page for me
AGTGCATCCTGAAGCGCAACACGGAAACACGGAGGCCAGCATTCAGATGAATTCAGATGAAGATCCGGCCGGAGCTGACCTCCGACATCCAGGGCATTATGTTCCCAGGATATTACGGCACCAGCTGTCCGCACATCTACGACGAGGCTGTGAAGGCCGGCCAGGTGTACACCTAAAGAACAGCTTCAAGATCCTGCCCGTACCCGACCGTCAGTTTGGAGATCCGGACAAGTGCACTCAATGTTAGCTTGATCGTATCTGCGTATCTGCATATGAGCAGGCCATTATTGCGGCATCCAGGGCATCCAGCCAGTGACGCAATATGCAAAGGATTCCACTGATCGGCTCAG

Full Affymetrix probeset data:

Annotations for 1641065_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime