Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641066_s_at:

>probe:Drosophila_2:1641066_s_at:199:417; Interrogation_Position=1022; Antisense; GAGCGCAGTCCCATATTCCTAGGAT
>probe:Drosophila_2:1641066_s_at:9:7; Interrogation_Position=1036; Antisense; ATTCCTAGGATCCAAGTCCGACGTG
>probe:Drosophila_2:1641066_s_at:666:587; Interrogation_Position=1059; Antisense; TGGAGGAGGCACTTAGCTACTTAAA
>probe:Drosophila_2:1641066_s_at:520:27; Interrogation_Position=589; Antisense; ATACGGTTCGGCCACAGCAATTGTC
>probe:Drosophila_2:1641066_s_at:243:111; Interrogation_Position=604; Antisense; AGCAATTGTCCTGGGTCTGGGTTCG
>probe:Drosophila_2:1641066_s_at:504:613; Interrogation_Position=633; Antisense; TGAATGGCTTCACTTATGACCCGGC
>probe:Drosophila_2:1641066_s_at:675:425; Interrogation_Position=663; Antisense; GAGAGTTCGTGCTGACCGATCCCAA
>probe:Drosophila_2:1641066_s_at:340:515; Interrogation_Position=756; Antisense; GTGTCTTCAACTACATTGCGGCCAA
>probe:Drosophila_2:1641066_s_at:555:173; Interrogation_Position=799; Antisense; AAAGCCCTATGGAGCGCGGTACGTG
>probe:Drosophila_2:1641066_s_at:426:65; Interrogation_Position=830; Antisense; ATGGTCGCGGATGTGCATCGCACCA
>probe:Drosophila_2:1641066_s_at:574:353; Interrogation_Position=849; Antisense; GCACCATTAAATACGGCGGCATCTT
>probe:Drosophila_2:1641066_s_at:227:347; Interrogation_Position=867; Antisense; GCATCTTTATCTATCCGGCAACAAA
>probe:Drosophila_2:1641066_s_at:228:177; Interrogation_Position=908; Antisense; AAACTTCGTCTGCTGTACGAGTGCG
>probe:Drosophila_2:1641066_s_at:530:321; Interrogation_Position=934; Antisense; GCCCATGGCCTATCTGATGATCCAG

Paste this into a BLAST search page for me
GAGCGCAGTCCCATATTCCTAGGATATTCCTAGGATCCAAGTCCGACGTGTGGAGGAGGCACTTAGCTACTTAAAATACGGTTCGGCCACAGCAATTGTCAGCAATTGTCCTGGGTCTGGGTTCGTGAATGGCTTCACTTATGACCCGGCGAGAGTTCGTGCTGACCGATCCCAAGTGTCTTCAACTACATTGCGGCCAAAAAGCCCTATGGAGCGCGGTACGTGATGGTCGCGGATGTGCATCGCACCAGCACCATTAAATACGGCGGCATCTTGCATCTTTATCTATCCGGCAACAAAAAACTTCGTCTGCTGTACGAGTGCGGCCCATGGCCTATCTGATGATCCAG

Full Affymetrix probeset data:

Annotations for 1641066_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime