FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641069_at:

>probe:Drosophila_2:1641069_at:520:309; Interrogation_Position=1637; Antisense; CCAGAGGTCACTGCAGCTGCTGGAT
>probe:Drosophila_2:1641069_at:654:95; Interrogation_Position=1675; Antisense; AGATTAAGACACTGCAGACCTCCTT
>probe:Drosophila_2:1641069_at:108:535; Interrogation_Position=1832; Antisense; GGTGCGCTCCAAGAAAATGTCGATG
>probe:Drosophila_2:1641069_at:85:65; Interrogation_Position=1854; Antisense; ATGGGCGAGAACTGCCACATGCTGC
>probe:Drosophila_2:1641069_at:390:153; Interrogation_Position=1870; Antisense; ACATGCTGCACTATGCCAACGAGTT
>probe:Drosophila_2:1641069_at:191:429; Interrogation_Position=1890; Antisense; GAGTTGGCGCGCAAGGACATCGAAA
>probe:Drosophila_2:1641069_at:370:165; Interrogation_Position=1912; Antisense; AAATCACGACACTGCGGAAAGCCAA
>probe:Drosophila_2:1641069_at:168:561; Interrogation_Position=1927; Antisense; GGAAAGCCAAATACGCCGCCGAGTC
>probe:Drosophila_2:1641069_at:17:49; Interrogation_Position=1968; Antisense; ATCCAGGACAAGGTGACATCTCAGC
>probe:Drosophila_2:1641069_at:461:267; Interrogation_Position=2028; Antisense; CAGGTGGACAGACTCGAACGTTGCA
>probe:Drosophila_2:1641069_at:225:357; Interrogation_Position=2050; Antisense; GCAAGACGCGCGAGGGTGCCAATCT
>probe:Drosophila_2:1641069_at:160:35; Interrogation_Position=2097; Antisense; ATCAGCTACATTGTTACCCGGGACG
>probe:Drosophila_2:1641069_at:601:407; Interrogation_Position=2124; Antisense; GACGGCAAGCGTCACATGCTGAACG
>probe:Drosophila_2:1641069_at:36:349; Interrogation_Position=2186; Antisense; GCAGGCGATCAATGCATCATTCCAG

Paste this into a BLAST search page for me
CCAGAGGTCACTGCAGCTGCTGGATAGATTAAGACACTGCAGACCTCCTTGGTGCGCTCCAAGAAAATGTCGATGATGGGCGAGAACTGCCACATGCTGCACATGCTGCACTATGCCAACGAGTTGAGTTGGCGCGCAAGGACATCGAAAAAATCACGACACTGCGGAAAGCCAAGGAAAGCCAAATACGCCGCCGAGTCATCCAGGACAAGGTGACATCTCAGCCAGGTGGACAGACTCGAACGTTGCAGCAAGACGCGCGAGGGTGCCAATCTATCAGCTACATTGTTACCCGGGACGGACGGCAAGCGTCACATGCTGAACGGCAGGCGATCAATGCATCATTCCAG

Full Affymetrix probeset data:

Annotations for 1641069_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720