FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641070_at:

>probe:Drosophila_2:1641070_at:728:341; Interrogation_Position=1105; Antisense; GCTTCAAGCCTGTGATTAACTACTT
>probe:Drosophila_2:1641070_at:251:431; Interrogation_Position=608; Antisense; GAGTACGTGCGCGTGTTCCTCGACC
>probe:Drosophila_2:1641070_at:480:261; Interrogation_Position=651; Antisense; CGACCATTAAGTTGCCCAACCGTCG
>probe:Drosophila_2:1641070_at:214:319; Interrogation_Position=718; Antisense; GCCCCGTACCGCCTTGAGGAATATG
>probe:Drosophila_2:1641070_at:293:365; Interrogation_Position=736; Antisense; GAATATGTACCAGCAACTCTACTCC
>probe:Drosophila_2:1641070_at:443:323; Interrogation_Position=823; Antisense; GCGCGATCTGCGTCAACTTAAGGAG
>probe:Drosophila_2:1641070_at:599:335; Interrogation_Position=834; Antisense; GTCAACTTAAGGAGTACCGCTCCCT
>probe:Drosophila_2:1641070_at:652:183; Interrogation_Position=873; Antisense; AAAAGTCTGGTGTTCCTCTGCGCCA
>probe:Drosophila_2:1641070_at:638:119; Interrogation_Position=897; Antisense; AGCTGCAGCAACTGGTGGCTAACGC
>probe:Drosophila_2:1641070_at:34:661; Interrogation_Position=916; Antisense; TAACGCCCTTGGTTGGAGCACCGTG
>probe:Drosophila_2:1641070_at:382:261; Interrogation_Position=934; Antisense; CACCGTGGACATGGCCGGAGAGACC
>probe:Drosophila_2:1641070_at:68:425; Interrogation_Position=951; Antisense; GAGAGACCGTCATCTGGAGTCTTTA
>probe:Drosophila_2:1641070_at:438:393; Interrogation_Position=982; Antisense; GAAAGTCTCTACAGTTTCTTCCTTT
>probe:Drosophila_2:1641070_at:627:477; Interrogation_Position=995; Antisense; GTTTCTTCCTTTTCATTTGTAGCTC

Paste this into a BLAST search page for me
GCTTCAAGCCTGTGATTAACTACTTGAGTACGTGCGCGTGTTCCTCGACCCGACCATTAAGTTGCCCAACCGTCGGCCCCGTACCGCCTTGAGGAATATGGAATATGTACCAGCAACTCTACTCCGCGCGATCTGCGTCAACTTAAGGAGGTCAACTTAAGGAGTACCGCTCCCTAAAAGTCTGGTGTTCCTCTGCGCCAAGCTGCAGCAACTGGTGGCTAACGCTAACGCCCTTGGTTGGAGCACCGTGCACCGTGGACATGGCCGGAGAGACCGAGAGACCGTCATCTGGAGTCTTTAGAAAGTCTCTACAGTTTCTTCCTTTGTTTCTTCCTTTTCATTTGTAGCTC

Full Affymetrix probeset data:

Annotations for 1641070_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720