FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641071_at:

>probe:Drosophila_2:1641071_at:440:705; Interrogation_Position=164; Antisense; TTAGTCTGCGCGATGGCAGGTTCGC
>probe:Drosophila_2:1641071_at:665:313; Interrogation_Position=187; Antisense; GCCATAGGTGCCTTTGCCAAAGTGA
>probe:Drosophila_2:1641071_at:46:511; Interrogation_Position=208; Antisense; GTGAACTGGTTCCAAGCTCAGGCCA
>probe:Drosophila_2:1641071_at:506:309; Interrogation_Position=241; Antisense; GCCTATGGGTACACGCTCGTAAGCA
>probe:Drosophila_2:1641071_at:60:293; Interrogation_Position=258; Antisense; CGTAAGCATTACATCCGAGCAGGAT
>probe:Drosophila_2:1641071_at:289:193; Interrogation_Position=310; Antisense; AACTACGCCCGGAACCAGCAGGATC
>probe:Drosophila_2:1641071_at:559:159; Interrogation_Position=380; Antisense; ACAACAACTGGGTGTGGTTCAGCAA
>probe:Drosophila_2:1641071_at:12:349; Interrogation_Position=425; Antisense; GCAACTTCCAGAACGGTCTACCGGG
>probe:Drosophila_2:1641071_at:327:33; Interrogation_Position=461; Antisense; ATAATCGCCACTGCCTTGGCATCAA
>probe:Drosophila_2:1641071_at:59:137; Interrogation_Position=509; Antisense; ACGAGAACTGCTCAGAGCTGCGCTA
>probe:Drosophila_2:1641071_at:501:119; Interrogation_Position=524; Antisense; AGCTGCGCTACTTCGTTTGCGAGAA
>probe:Drosophila_2:1641071_at:245:717; Interrogation_Position=535; Antisense; TTCGTTTGCGAGAAGCGTTGCCAGT
>probe:Drosophila_2:1641071_at:21:327; Interrogation_Position=549; Antisense; GCGTTGCCAGTTCGATGACGACGTA
>probe:Drosophila_2:1641071_at:83:505; Interrogation_Position=75; Antisense; GTCCTTGCCAGAATCGGACCTCTTA

Paste this into a BLAST search page for me
TTAGTCTGCGCGATGGCAGGTTCGCGCCATAGGTGCCTTTGCCAAAGTGAGTGAACTGGTTCCAAGCTCAGGCCAGCCTATGGGTACACGCTCGTAAGCACGTAAGCATTACATCCGAGCAGGATAACTACGCCCGGAACCAGCAGGATCACAACAACTGGGTGTGGTTCAGCAAGCAACTTCCAGAACGGTCTACCGGGATAATCGCCACTGCCTTGGCATCAAACGAGAACTGCTCAGAGCTGCGCTAAGCTGCGCTACTTCGTTTGCGAGAATTCGTTTGCGAGAAGCGTTGCCAGTGCGTTGCCAGTTCGATGACGACGTAGTCCTTGCCAGAATCGGACCTCTTA

Full Affymetrix probeset data:

Annotations for 1641071_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720