Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641072_at:

>probe:Drosophila_2:1641072_at:172:413; Interrogation_Position=4110; Antisense; GATGTACTCCTAAACAGTCGTTAGC
>probe:Drosophila_2:1641072_at:361:237; Interrogation_Position=4124; Antisense; CAGTCGTTAGCCTAAGTTACCTAAG
>probe:Drosophila_2:1641072_at:147:475; Interrogation_Position=4139; Antisense; GTTACCTAAGTTACCTACGATGCTA
>probe:Drosophila_2:1641072_at:88:131; Interrogation_Position=4151; Antisense; ACCTACGATGCTAAATTGTTTGTCT
>probe:Drosophila_2:1641072_at:523:495; Interrogation_Position=4172; Antisense; GTCTTAGTTTGTTTCTACCCATGTA
>probe:Drosophila_2:1641072_at:498:299; Interrogation_Position=4201; Antisense; CCCAACCAATGCGAGAGTTTGTTTT
>probe:Drosophila_2:1641072_at:151:561; Interrogation_Position=4272; Antisense; GGAAATGTTTTCTAATTGCCCATAG
>probe:Drosophila_2:1641072_at:681:227; Interrogation_Position=4301; Antisense; AATGGTTGTGACTAATCGCTTGGCA
>probe:Drosophila_2:1641072_at:67:405; Interrogation_Position=4310; Antisense; GACTAATCGCTTGGCATACCTTAAA
>probe:Drosophila_2:1641072_at:8:29; Interrogation_Position=4325; Antisense; ATACCTTAAAGCAGTCGCCGCATGC
>probe:Drosophila_2:1641072_at:529:319; Interrogation_Position=4341; Antisense; GCCGCATGCGGCAACATTGTGTGTA
>probe:Drosophila_2:1641072_at:52:469; Interrogation_Position=4378; Antisense; GTTGAGGCGCTGAAAAGTCTTACAT
>probe:Drosophila_2:1641072_at:400:59; Interrogation_Position=4405; Antisense; ATGATATACGCAATAGGCCACTAAG
>probe:Drosophila_2:1641072_at:31:595; Interrogation_Position=4434; Antisense; TGTGTACGTACTTCTGATTGAGGGA

Paste this into a BLAST search page for me
GATGTACTCCTAAACAGTCGTTAGCCAGTCGTTAGCCTAAGTTACCTAAGGTTACCTAAGTTACCTACGATGCTAACCTACGATGCTAAATTGTTTGTCTGTCTTAGTTTGTTTCTACCCATGTACCCAACCAATGCGAGAGTTTGTTTTGGAAATGTTTTCTAATTGCCCATAGAATGGTTGTGACTAATCGCTTGGCAGACTAATCGCTTGGCATACCTTAAAATACCTTAAAGCAGTCGCCGCATGCGCCGCATGCGGCAACATTGTGTGTAGTTGAGGCGCTGAAAAGTCTTACATATGATATACGCAATAGGCCACTAAGTGTGTACGTACTTCTGATTGAGGGA

Full Affymetrix probeset data:

Annotations for 1641072_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime