Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641075_at:

>probe:Drosophila_2:1641075_at:666:377; Interrogation_Position=7732; Antisense; GAAGCTTTATCGCTATGACGCCGAA
>probe:Drosophila_2:1641075_at:572:587; Interrogation_Position=7800; Antisense; TGGAGCACCCGGAGCTGCAGACATT
>probe:Drosophila_2:1641075_at:120:619; Interrogation_Position=7815; Antisense; TGCAGACATTCCGACTGATCATGCG
>probe:Drosophila_2:1641075_at:209:35; Interrogation_Position=7832; Antisense; ATCATGCGGCAGGAGCAGATCCACA
>probe:Drosophila_2:1641075_at:371:619; Interrogation_Position=7863; Antisense; TGCTTAACATGAATATCTCCGCCTC
>probe:Drosophila_2:1641075_at:715:613; Interrogation_Position=7917; Antisense; TGAAGAGCTTCCTGTGGGCCGGCTA
>probe:Drosophila_2:1641075_at:191:289; Interrogation_Position=7936; Antisense; CGGCTACAACTACGCGGTGGACGCA
>probe:Drosophila_2:1641075_at:571:93; Interrogation_Position=7969; Antisense; AGTTGACACCGAGGGCGTCCTGGAA
>probe:Drosophila_2:1641075_at:626:721; Interrogation_Position=7998; Antisense; TTGCCTGTCGATTCGCCAAGGAAGA
>probe:Drosophila_2:1641075_at:379:375; Interrogation_Position=8018; Antisense; GAAGAGATCGCCAGTGAGTTCCTCA
>probe:Drosophila_2:1641075_at:102:427; Interrogation_Position=8033; Antisense; GAGTTCCTCAACACGGTCAATTCGT
>probe:Drosophila_2:1641075_at:458:181; Interrogation_Position=8062; Antisense; AAAACGAGCCAAGGCCTTGCAAGGT
>probe:Drosophila_2:1641075_at:460:159; Interrogation_Position=8097; Antisense; ACAAGAATGACGACGCGCCGGAGGA
>probe:Drosophila_2:1641075_at:259:419; Interrogation_Position=8128; Antisense; GAGCTCATAAGCAAACCGGATCTAA

Paste this into a BLAST search page for me
GAAGCTTTATCGCTATGACGCCGAATGGAGCACCCGGAGCTGCAGACATTTGCAGACATTCCGACTGATCATGCGATCATGCGGCAGGAGCAGATCCACATGCTTAACATGAATATCTCCGCCTCTGAAGAGCTTCCTGTGGGCCGGCTACGGCTACAACTACGCGGTGGACGCAAGTTGACACCGAGGGCGTCCTGGAATTGCCTGTCGATTCGCCAAGGAAGAGAAGAGATCGCCAGTGAGTTCCTCAGAGTTCCTCAACACGGTCAATTCGTAAAACGAGCCAAGGCCTTGCAAGGTACAAGAATGACGACGCGCCGGAGGAGAGCTCATAAGCAAACCGGATCTAA

Full Affymetrix probeset data:

Annotations for 1641075_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime