FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641076_at:

>probe:Drosophila_2:1641076_at:267:507; Interrogation_Position=105; Antisense; GTGAGTTGGAGTGGCCCAACACCTC
>probe:Drosophila_2:1641076_at:604:253; Interrogation_Position=121; Antisense; CAACACCTCTTTTCAGCAAAACTGC
>probe:Drosophila_2:1641076_at:48:529; Interrogation_Position=180; Antisense; GGGAGAAACTTCAAGGAACTGCGAA
>probe:Drosophila_2:1641076_at:6:161; Interrogation_Position=196; Antisense; AACTGCGAAGGAATGGTTCACCCAC
>probe:Drosophila_2:1641076_at:17:219; Interrogation_Position=203; Antisense; AAGGAATGGTTCACCCACCAATCTT
>probe:Drosophila_2:1641076_at:673:127; Interrogation_Position=219; Antisense; ACCAATCTTCAGCATAGCCATGGAT
>probe:Drosophila_2:1641076_at:311:547; Interrogation_Position=282; Antisense; GGATGAGATCATTAACCAAGTTGCA
>probe:Drosophila_2:1641076_at:716:677; Interrogation_Position=293; Antisense; TTAACCAAGTTGCATTTCGTTGGGA
>probe:Drosophila_2:1641076_at:278:33; Interrogation_Position=338; Antisense; ATCACTTGAATATTCTTTCTTGTTC
>probe:Drosophila_2:1641076_at:115:697; Interrogation_Position=353; Antisense; TTTCTTGTTCTCTCATTTCAGCTGG
>probe:Drosophila_2:1641076_at:228:643; Interrogation_Position=363; Antisense; TCTCATTTCAGCTGGCGCTTTGTCG
>probe:Drosophila_2:1641076_at:149:149; Interrogation_Position=532; Antisense; ACTATTGGATTCGTAAGTGGCTGCC
>probe:Drosophila_2:1641076_at:487:657; Interrogation_Position=545; Antisense; TAAGTGGCTGCCATATTCCTTCCAT
>probe:Drosophila_2:1641076_at:513:719; Interrogation_Position=564; Antisense; TTCCATCCCATATCGGTCTTATTGA

Paste this into a BLAST search page for me
GTGAGTTGGAGTGGCCCAACACCTCCAACACCTCTTTTCAGCAAAACTGCGGGAGAAACTTCAAGGAACTGCGAAAACTGCGAAGGAATGGTTCACCCACAAGGAATGGTTCACCCACCAATCTTACCAATCTTCAGCATAGCCATGGATGGATGAGATCATTAACCAAGTTGCATTAACCAAGTTGCATTTCGTTGGGAATCACTTGAATATTCTTTCTTGTTCTTTCTTGTTCTCTCATTTCAGCTGGTCTCATTTCAGCTGGCGCTTTGTCGACTATTGGATTCGTAAGTGGCTGCCTAAGTGGCTGCCATATTCCTTCCATTTCCATCCCATATCGGTCTTATTGA

Full Affymetrix probeset data:

Annotations for 1641076_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720