FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641077_at:

>probe:Drosophila_2:1641077_at:447:99; Interrogation_Position=3052; Antisense; AGAGGCGTCTGAATGGCCCCAAAAT
>probe:Drosophila_2:1641077_at:44:431; Interrogation_Position=3083; Antisense; GAGTATTGTATTCGTCCATGGAGGA
>probe:Drosophila_2:1641077_at:424:159; Interrogation_Position=3284; Antisense; ACAAATCTGCTGACTAGTCGTCGCC
>probe:Drosophila_2:1641077_at:335:313; Interrogation_Position=3306; Antisense; GCCACTCGCGTATATCATGAACCAA
>probe:Drosophila_2:1641077_at:687:221; Interrogation_Position=3340; Antisense; AAGGGTGCGGAGGATTCCACCCTAT
>probe:Drosophila_2:1641077_at:475:137; Interrogation_Position=3376; Antisense; ACGAGGGACCGCGAGATGCTCGATA
>probe:Drosophila_2:1641077_at:459:445; Interrogation_Position=3390; Antisense; GATGCTCGATATCTTATCCGACCTA
>probe:Drosophila_2:1641077_at:582:21; Interrogation_Position=3432; Antisense; ATATTCGTCTACGTAGTTCGATTGA
>probe:Drosophila_2:1641077_at:666:725; Interrogation_Position=3453; Antisense; TTGATTGAGCGCACTTACACTTACC
>probe:Drosophila_2:1641077_at:56:155; Interrogation_Position=3469; Antisense; ACACTTACCTACTCTACTGAATCGA
>probe:Drosophila_2:1641077_at:466:143; Interrogation_Position=3484; Antisense; ACTGAATCGAAGGATCGTGGCCCAT
>probe:Drosophila_2:1641077_at:394:521; Interrogation_Position=3500; Antisense; GTGGCCCATGGACTACACGTAGTCT
>probe:Drosophila_2:1641077_at:691:13; Interrogation_Position=3537; Antisense; ATTAACTCTCTAAGTGTGCGTATGT
>probe:Drosophila_2:1641077_at:554:507; Interrogation_Position=3552; Antisense; GTGCGTATGTGTGTCATGTACTTGT

Paste this into a BLAST search page for me
AGAGGCGTCTGAATGGCCCCAAAATGAGTATTGTATTCGTCCATGGAGGAACAAATCTGCTGACTAGTCGTCGCCGCCACTCGCGTATATCATGAACCAAAAGGGTGCGGAGGATTCCACCCTATACGAGGGACCGCGAGATGCTCGATAGATGCTCGATATCTTATCCGACCTAATATTCGTCTACGTAGTTCGATTGATTGATTGAGCGCACTTACACTTACCACACTTACCTACTCTACTGAATCGAACTGAATCGAAGGATCGTGGCCCATGTGGCCCATGGACTACACGTAGTCTATTAACTCTCTAAGTGTGCGTATGTGTGCGTATGTGTGTCATGTACTTGT

Full Affymetrix probeset data:

Annotations for 1641077_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720