FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641081_at:

>probe:Drosophila_2:1641081_at:149:221; Interrogation_Position=333; Antisense; AATGGCCAAAACTGATCCTCCCGTT
>probe:Drosophila_2:1641081_at:530:447; Interrogation_Position=346; Antisense; GATCCTCCCGTTACTGTCAAAGCGA
>probe:Drosophila_2:1641081_at:277:617; Interrogation_Position=431; Antisense; TGCTTACAAAGAACGGGTCCTGCCA
>probe:Drosophila_2:1641081_at:93:181; Interrogation_Position=477; Antisense; AAAAAAGCCCCATCTGCGCTCTTGT
>probe:Drosophila_2:1641081_at:54:191; Interrogation_Position=512; Antisense; AACATTTTAGTCCAACTCGTCGCAT
>probe:Drosophila_2:1641081_at:119:639; Interrogation_Position=528; Antisense; TCGTCGCATTTGCATGAAGGCCTCA
>probe:Drosophila_2:1641081_at:676:171; Interrogation_Position=586; Antisense; AAAGAATCAGATGGTCCTGCCACCA
>probe:Drosophila_2:1641081_at:406:389; Interrogation_Position=637; Antisense; GAAAACTCTCTTGTTGCTCATCGCA
>probe:Drosophila_2:1641081_at:424:647; Interrogation_Position=654; Antisense; TCATCGCAGCGATTGTGGCAAGTTT
>probe:Drosophila_2:1641081_at:664:519; Interrogation_Position=668; Antisense; GTGGCAAGTTTATGCTCTGCAGCAA
>probe:Drosophila_2:1641081_at:49:691; Interrogation_Position=702; Antisense; TTTGGTAATGGACTGCCCAACTGGC
>probe:Drosophila_2:1641081_at:710:253; Interrogation_Position=719; Antisense; CAACTGGCCTGCATTTCAATATAGC
>probe:Drosophila_2:1641081_at:92:153; Interrogation_Position=745; Antisense; ACATCACGATGCGATTATCCCAAAA
>probe:Drosophila_2:1641081_at:30:495; Interrogation_Position=810; Antisense; GTCAAAGAAACCTGTGCGCAAGTCA

Paste this into a BLAST search page for me
AATGGCCAAAACTGATCCTCCCGTTGATCCTCCCGTTACTGTCAAAGCGATGCTTACAAAGAACGGGTCCTGCCAAAAAAAGCCCCATCTGCGCTCTTGTAACATTTTAGTCCAACTCGTCGCATTCGTCGCATTTGCATGAAGGCCTCAAAAGAATCAGATGGTCCTGCCACCAGAAAACTCTCTTGTTGCTCATCGCATCATCGCAGCGATTGTGGCAAGTTTGTGGCAAGTTTATGCTCTGCAGCAATTTGGTAATGGACTGCCCAACTGGCCAACTGGCCTGCATTTCAATATAGCACATCACGATGCGATTATCCCAAAAGTCAAAGAAACCTGTGCGCAAGTCA

Full Affymetrix probeset data:

Annotations for 1641081_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720