FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641082_at:

>probe:Drosophila_2:1641082_at:183:449; Interrogation_Position=1002; Antisense; GATCCTAAGCAATCTTCTGGCCTAT
>probe:Drosophila_2:1641082_at:160:317; Interrogation_Position=535; Antisense; GCCGGTCTACCGGATGAATTGCTTC
>probe:Drosophila_2:1641082_at:271:55; Interrogation_Position=548; Antisense; ATGAATTGCTTCCTGGGATCGCTGC
>probe:Drosophila_2:1641082_at:338:323; Interrogation_Position=582; Antisense; GCGCCATTCCTGTGCATCGTCAGAA
>probe:Drosophila_2:1641082_at:369:347; Interrogation_Position=595; Antisense; GCATCGTCAGAACTGTTTCCTTAGG
>probe:Drosophila_2:1641082_at:371:709; Interrogation_Position=611; Antisense; TTCCTTAGGGAACAGTCGCAGCAGC
>probe:Drosophila_2:1641082_at:431:547; Interrogation_Position=640; Antisense; GGATGAGATTTCCATACCTCGGCTG
>probe:Drosophila_2:1641082_at:422:121; Interrogation_Position=705; Antisense; AGCGCGTGGACGTCTGTTCGAAGCC
>probe:Drosophila_2:1641082_at:539:603; Interrogation_Position=719; Antisense; TGTTCGAAGCCAAGACGCACAGCGT
>probe:Drosophila_2:1641082_at:444:599; Interrogation_Position=772; Antisense; TGTCATGCGCTCGATTCGCATCTAG
>probe:Drosophila_2:1641082_at:293:635; Interrogation_Position=787; Antisense; TCGCATCTAGGTCGCCAATCATGGA
>probe:Drosophila_2:1641082_at:32:543; Interrogation_Position=809; Antisense; GGATTGTACATAGCTCTACTACGTA
>probe:Drosophila_2:1641082_at:583:377; Interrogation_Position=874; Antisense; GAACCATTGTTCCTAAGACTTACAC
>probe:Drosophila_2:1641082_at:271:403; Interrogation_Position=890; Antisense; GACTTACACTGCAGTAATCGCACCA

Paste this into a BLAST search page for me
GATCCTAAGCAATCTTCTGGCCTATGCCGGTCTACCGGATGAATTGCTTCATGAATTGCTTCCTGGGATCGCTGCGCGCCATTCCTGTGCATCGTCAGAAGCATCGTCAGAACTGTTTCCTTAGGTTCCTTAGGGAACAGTCGCAGCAGCGGATGAGATTTCCATACCTCGGCTGAGCGCGTGGACGTCTGTTCGAAGCCTGTTCGAAGCCAAGACGCACAGCGTTGTCATGCGCTCGATTCGCATCTAGTCGCATCTAGGTCGCCAATCATGGAGGATTGTACATAGCTCTACTACGTAGAACCATTGTTCCTAAGACTTACACGACTTACACTGCAGTAATCGCACCA

Full Affymetrix probeset data:

Annotations for 1641082_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720