Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641083_at:

>probe:Drosophila_2:1641083_at:573:475; Interrogation_Position=2352; Antisense; GTTATCCACATCAGCAAACCGTAGA
>probe:Drosophila_2:1641083_at:245:505; Interrogation_Position=2397; Antisense; GTGCCATTTTACACCCAAATCGATG
>probe:Drosophila_2:1641083_at:222:175; Interrogation_Position=2446; Antisense; AAACCAAGTTAGCTCCATCGAAATG
>probe:Drosophila_2:1641083_at:467:227; Interrogation_Position=2467; Antisense; AATGGCGATACGAACCTAGTTACTC
>probe:Drosophila_2:1641083_at:568:223; Interrogation_Position=2520; Antisense; AAGGTCAATTGGTCCTCATTTAGAG
>probe:Drosophila_2:1641083_at:239:231; Interrogation_Position=2551; Antisense; AATGTTCATTACTTGCTTTCCGTGT
>probe:Drosophila_2:1641083_at:730:341; Interrogation_Position=2565; Antisense; GCTTTCCGTGTACGTTGACGACATT
>probe:Drosophila_2:1641083_at:433:441; Interrogation_Position=2597; Antisense; GATGGATCTGGTTTCACTGGACAAA
>probe:Drosophila_2:1641083_at:371:235; Interrogation_Position=2620; Antisense; AATCCACTCCGATTAGCACTCGAAA
>probe:Drosophila_2:1641083_at:694:39; Interrogation_Position=2733; Antisense; ATCGATACCAAGTACTTTTTCCAAG
>probe:Drosophila_2:1641083_at:380:321; Interrogation_Position=2784; Antisense; GCCCGAACTCGCATCAGCATAGAAA
>probe:Drosophila_2:1641083_at:511:221; Interrogation_Position=2836; Antisense; AAGGATTGTATTTCGGGCTCTGGGA
>probe:Drosophila_2:1641083_at:453:571; Interrogation_Position=2854; Antisense; TCTGGGAGGTTTTCAAAGTCGGACT
>probe:Drosophila_2:1641083_at:137:89; Interrogation_Position=2870; Antisense; AGTCGGACTCCTGTGCTTGAAAAAC

Paste this into a BLAST search page for me
GTTATCCACATCAGCAAACCGTAGAGTGCCATTTTACACCCAAATCGATGAAACCAAGTTAGCTCCATCGAAATGAATGGCGATACGAACCTAGTTACTCAAGGTCAATTGGTCCTCATTTAGAGAATGTTCATTACTTGCTTTCCGTGTGCTTTCCGTGTACGTTGACGACATTGATGGATCTGGTTTCACTGGACAAAAATCCACTCCGATTAGCACTCGAAAATCGATACCAAGTACTTTTTCCAAGGCCCGAACTCGCATCAGCATAGAAAAAGGATTGTATTTCGGGCTCTGGGATCTGGGAGGTTTTCAAAGTCGGACTAGTCGGACTCCTGTGCTTGAAAAAC

Full Affymetrix probeset data:

Annotations for 1641083_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime