FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641084_at:

>probe:Drosophila_2:1641084_at:75:285; Interrogation_Position=1011; Antisense; CTGAATCGAGGATTGCAGCCGAGCA
>probe:Drosophila_2:1641084_at:215:197; Interrogation_Position=1076; Antisense; AACTGGACAAGAGCGCGAGCACCAC
>probe:Drosophila_2:1641084_at:335:267; Interrogation_Position=1113; Antisense; CAGTGCACAGTGGTTCGATTTGGCT
>probe:Drosophila_2:1641084_at:271:423; Interrogation_Position=620; Antisense; GGGTGGACGAACAGGTCAACTTCCT
>probe:Drosophila_2:1641084_at:97:607; Interrogation_Position=674; Antisense; TGATGCAGTCCACCAGCCAGGATCT
>probe:Drosophila_2:1641084_at:600:451; Interrogation_Position=694; Antisense; GATCTGGCCAGGTGCAAGAGTGTCC
>probe:Drosophila_2:1641084_at:264:213; Interrogation_Position=709; Antisense; AAGAGTGTCCTCCATGTGGGCGACT
>probe:Drosophila_2:1641084_at:96:297; Interrogation_Position=735; Antisense; CGACTACAACTACCTGATCAGCTTT
>probe:Drosophila_2:1641084_at:218:117; Interrogation_Position=754; Antisense; AGCTTTCTGCCGCTGATGAAGCAAA
>probe:Drosophila_2:1641084_at:644:167; Interrogation_Position=776; Antisense; AAATGACGCCCTTCCAGAATGTCTT
>probe:Drosophila_2:1641084_at:600:109; Interrogation_Position=791; Antisense; AGAATGTCTTCTTCAGGGCCAAGAT
>probe:Drosophila_2:1641084_at:622:113; Interrogation_Position=929; Antisense; AGCAGCCCTCGCAAATGTTGTTGAA
>probe:Drosophila_2:1641084_at:689:357; Interrogation_Position=960; Antisense; GCAAATGGCCTTGGATCAGGCGCAA
>probe:Drosophila_2:1641084_at:333:645; Interrogation_Position=975; Antisense; TCAGGCGCAAGTGAGCACAAGCTCC

Paste this into a BLAST search page for me
CTGAATCGAGGATTGCAGCCGAGCAAACTGGACAAGAGCGCGAGCACCACCAGTGCACAGTGGTTCGATTTGGCTGGGTGGACGAACAGGTCAACTTCCTTGATGCAGTCCACCAGCCAGGATCTGATCTGGCCAGGTGCAAGAGTGTCCAAGAGTGTCCTCCATGTGGGCGACTCGACTACAACTACCTGATCAGCTTTAGCTTTCTGCCGCTGATGAAGCAAAAAATGACGCCCTTCCAGAATGTCTTAGAATGTCTTCTTCAGGGCCAAGATAGCAGCCCTCGCAAATGTTGTTGAAGCAAATGGCCTTGGATCAGGCGCAATCAGGCGCAAGTGAGCACAAGCTCC

Full Affymetrix probeset data:

Annotations for 1641084_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720