FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641086_at:

>probe:Drosophila_2:1641086_at:203:317; Interrogation_Position=115; Antisense; GCCGTCGGGCTCATTGTGCTGCGAT
>probe:Drosophila_2:1641086_at:47:647; Interrogation_Position=125; Antisense; TCATTGTGCTGCGATGGTGGATGTC
>probe:Drosophila_2:1641086_at:502:55; Interrogation_Position=13; Antisense; ATGAAGCCGAAAAAGCCGCAGGATC
>probe:Drosophila_2:1641086_at:355:501; Interrogation_Position=153; Antisense; GTCGATGGTCGGATTCGATGGCCAT
>probe:Drosophila_2:1641086_at:200:295; Interrogation_Position=20; Antisense; CGAAAAAGCCGCAGGATCAGGAGCA
>probe:Drosophila_2:1641086_at:93:371; Interrogation_Position=240; Antisense; GAAGGGTTCGATATGCAAACAACAA
>probe:Drosophila_2:1641086_at:380:619; Interrogation_Position=269; Antisense; TGCGCAAATTGTTTGGATCCCCGCT
>probe:Drosophila_2:1641086_at:626:253; Interrogation_Position=273; Antisense; CAAATTGTTTGGATCCCCGCTTGGG
>probe:Drosophila_2:1641086_at:289:429; Interrogation_Position=368; Antisense; GAGTTTTGCAGTCGGCTCACGGCCT
>probe:Drosophila_2:1641086_at:251:141; Interrogation_Position=386; Antisense; ACGGCCTGCCCTTTGTGGTGAATGG
>probe:Drosophila_2:1641086_at:556:277; Interrogation_Position=396; Antisense; CTTTGTGGTGAATGGGTCTGCTTGA
>probe:Drosophila_2:1641086_at:101:551; Interrogation_Position=47; Antisense; GGAGTCCTGGACCAGAAGTCCACAA
>probe:Drosophila_2:1641086_at:590:83; Interrogation_Position=77; Antisense; AGTGGCAGACCGGAAGCGCTGCACT
>probe:Drosophila_2:1641086_at:43:563; Interrogation_Position=88; Antisense; GGAAGCGCTGCACTGCGTTCACTTC

Paste this into a BLAST search page for me
GCCGTCGGGCTCATTGTGCTGCGATTCATTGTGCTGCGATGGTGGATGTCATGAAGCCGAAAAAGCCGCAGGATCGTCGATGGTCGGATTCGATGGCCATCGAAAAAGCCGCAGGATCAGGAGCAGAAGGGTTCGATATGCAAACAACAATGCGCAAATTGTTTGGATCCCCGCTCAAATTGTTTGGATCCCCGCTTGGGGAGTTTTGCAGTCGGCTCACGGCCTACGGCCTGCCCTTTGTGGTGAATGGCTTTGTGGTGAATGGGTCTGCTTGAGGAGTCCTGGACCAGAAGTCCACAAAGTGGCAGACCGGAAGCGCTGCACTGGAAGCGCTGCACTGCGTTCACTTC

Full Affymetrix probeset data:

Annotations for 1641086_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720