Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641088_at:

>probe:Drosophila_2:1641088_at:254:3; Interrogation_Position=1024; Antisense; ATTAACCGCGGGACCTGTAGTCGTG
>probe:Drosophila_2:1641088_at:24:241; Interrogation_Position=1101; Antisense; AATCAAGGATCAAAGGTCGCCCCAC
>probe:Drosophila_2:1641088_at:582:487; Interrogation_Position=1149; Antisense; GTACCATATGCCATTTGACCTTTTG
>probe:Drosophila_2:1641088_at:197:723; Interrogation_Position=588; Antisense; TTGCTGACCGAACAAGGCTTCATCA
>probe:Drosophila_2:1641088_at:226:239; Interrogation_Position=614; Antisense; AATCTATAAGCAATTCTTCCCCGAC
>probe:Drosophila_2:1641088_at:443:405; Interrogation_Position=636; Antisense; GACGGAGACCCCAGCAAATTTGCCT
>probe:Drosophila_2:1641088_at:360:161; Interrogation_Position=651; Antisense; AAATTTGCCTCCCTGGTCTTTCGTG
>probe:Drosophila_2:1641088_at:306:711; Interrogation_Position=708; Antisense; TTCGAGGAGTTCATTCGGGCCCTGT
>probe:Drosophila_2:1641088_at:687:597; Interrogation_Position=730; Antisense; TGTCCATCACATCACGCGGAAATCT
>probe:Drosophila_2:1641088_at:24:423; Interrogation_Position=759; Antisense; GAGAAGCTGCACTGGGCTTTCCGTT
>probe:Drosophila_2:1641088_at:590:339; Interrogation_Position=774; Antisense; GCTTTCCGTTTGTACGACGTGGACA
>probe:Drosophila_2:1641088_at:559:137; Interrogation_Position=799; Antisense; ACGATGGCTATATAACACGCGAGGA
>probe:Drosophila_2:1641088_at:131:591; Interrogation_Position=856; Antisense; TGGTAGGACAACAGCCGCAGACGGA
>probe:Drosophila_2:1641088_at:289:137; Interrogation_Position=940; Antisense; ACGACGATCGACTGACGCTGGAGGA

Paste this into a BLAST search page for me
ATTAACCGCGGGACCTGTAGTCGTGAATCAAGGATCAAAGGTCGCCCCACGTACCATATGCCATTTGACCTTTTGTTGCTGACCGAACAAGGCTTCATCAAATCTATAAGCAATTCTTCCCCGACGACGGAGACCCCAGCAAATTTGCCTAAATTTGCCTCCCTGGTCTTTCGTGTTCGAGGAGTTCATTCGGGCCCTGTTGTCCATCACATCACGCGGAAATCTGAGAAGCTGCACTGGGCTTTCCGTTGCTTTCCGTTTGTACGACGTGGACAACGATGGCTATATAACACGCGAGGATGGTAGGACAACAGCCGCAGACGGAACGACGATCGACTGACGCTGGAGGA

Full Affymetrix probeset data:

Annotations for 1641088_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime