Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641091_at:

>probe:Drosophila_2:1641091_at:698:501; Interrogation_Position=5318; Antisense; GTCGCAAGAAGATCGGCAACCTGTT
>probe:Drosophila_2:1641091_at:473:201; Interrogation_Position=5335; Antisense; AACCTGTTGGCCCTGGTTCGTGAAG
>probe:Drosophila_2:1641091_at:374:471; Interrogation_Position=5350; Antisense; GTTCGTGAAGCCGTCAATCTCAAAA
>probe:Drosophila_2:1641091_at:285:129; Interrogation_Position=5457; Antisense; ACCATCAGTATTGTCCAGCGTGTCC
>probe:Drosophila_2:1641091_at:118:517; Interrogation_Position=5476; Antisense; GTGTCCAGTTCGACGGCCTTGGAAA
>probe:Drosophila_2:1641091_at:325:197; Interrogation_Position=5628; Antisense; AACGGCCACCATGGATGACCTGGAG
>probe:Drosophila_2:1641091_at:444:421; Interrogation_Position=5650; Antisense; GAGGAACTGGACACAGCCGGTCCTA
>probe:Drosophila_2:1641091_at:431:689; Interrogation_Position=5673; Antisense; TATTACATTTCCCAGGCGCAGCGAT
>probe:Drosophila_2:1641091_at:525:45; Interrogation_Position=5702; Antisense; ATCGCCGTCGCACTATGAGACAGGA
>probe:Drosophila_2:1641091_at:346:461; Interrogation_Position=5725; Antisense; GATTCACAGAGCTCCATTTGGTCGG
>probe:Drosophila_2:1641091_at:194:149; Interrogation_Position=5761; Antisense; ACTATTACTATAAGCACCACCGGCA
>probe:Drosophila_2:1641091_at:293:127; Interrogation_Position=5776; Antisense; ACCACCGGCAGCGATGAGTGCATTG
>probe:Drosophila_2:1641091_at:341:431; Interrogation_Position=5791; Antisense; GAGTGCATTGTGGACGCAGCTGCTC
>probe:Drosophila_2:1641091_at:127:289; Interrogation_Position=5852; Antisense; CGGAGCCCACGGTCAACATTATAAG

Paste this into a BLAST search page for me
GTCGCAAGAAGATCGGCAACCTGTTAACCTGTTGGCCCTGGTTCGTGAAGGTTCGTGAAGCCGTCAATCTCAAAAACCATCAGTATTGTCCAGCGTGTCCGTGTCCAGTTCGACGGCCTTGGAAAAACGGCCACCATGGATGACCTGGAGGAGGAACTGGACACAGCCGGTCCTATATTACATTTCCCAGGCGCAGCGATATCGCCGTCGCACTATGAGACAGGAGATTCACAGAGCTCCATTTGGTCGGACTATTACTATAAGCACCACCGGCAACCACCGGCAGCGATGAGTGCATTGGAGTGCATTGTGGACGCAGCTGCTCCGGAGCCCACGGTCAACATTATAAG

Full Affymetrix probeset data:

Annotations for 1641091_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime