FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641092_at:

>probe:Drosophila_2:1641092_at:692:505; Interrogation_Position=1016; Antisense; GTGCGACGATCTGTGGGAATTCCCA
>probe:Drosophila_2:1641092_at:376:561; Interrogation_Position=1051; Antisense; GGAACTCAGTGAGCCGTACGATCTG
>probe:Drosophila_2:1641092_at:331:205; Interrogation_Position=1130; Antisense; AAGCCGGCAGCCAAATGATCTAGTC
>probe:Drosophila_2:1641092_at:390:91; Interrogation_Position=1196; Antisense; AGTTTGTTTAAATGCGACTGCGCCA
>probe:Drosophila_2:1641092_at:244:625; Interrogation_Position=1214; Antisense; TGCGCCACTGTAATTCATCATCATC
>probe:Drosophila_2:1641092_at:630:643; Interrogation_Position=1237; Antisense; TCATTCTTAAGCTCCAACATCTCAG
>probe:Drosophila_2:1641092_at:479:13; Interrogation_Position=704; Antisense; ATTCAAGCTCAAATCGTGACCACCG
>probe:Drosophila_2:1641092_at:419:659; Interrogation_Position=778; Antisense; TAACTCTTATATCCTGCCTGTAGCA
>probe:Drosophila_2:1641092_at:629:79; Interrogation_Position=805; Antisense; AGGTCTTATCAATTTGGCCATCATT
>probe:Drosophila_2:1641092_at:722:509; Interrogation_Position=833; Antisense; GTGCAAGCCATGTCTAGAACTCGTC
>probe:Drosophila_2:1641092_at:440:39; Interrogation_Position=878; Antisense; ATCGCCAACAATGTGTTCCGTGGAT
>probe:Drosophila_2:1641092_at:266:607; Interrogation_Position=912; Antisense; TGATGGTTCCAGTAGCCTGTACAGT
>probe:Drosophila_2:1641092_at:646:489; Interrogation_Position=930; Antisense; GTACAGTGCCTTCAGCTTTATGTGT
>probe:Drosophila_2:1641092_at:5:487; Interrogation_Position=962; Antisense; GTAGCTTCCAGCAGTTTTGGCCTTG

Paste this into a BLAST search page for me
GTGCGACGATCTGTGGGAATTCCCAGGAACTCAGTGAGCCGTACGATCTGAAGCCGGCAGCCAAATGATCTAGTCAGTTTGTTTAAATGCGACTGCGCCATGCGCCACTGTAATTCATCATCATCTCATTCTTAAGCTCCAACATCTCAGATTCAAGCTCAAATCGTGACCACCGTAACTCTTATATCCTGCCTGTAGCAAGGTCTTATCAATTTGGCCATCATTGTGCAAGCCATGTCTAGAACTCGTCATCGCCAACAATGTGTTCCGTGGATTGATGGTTCCAGTAGCCTGTACAGTGTACAGTGCCTTCAGCTTTATGTGTGTAGCTTCCAGCAGTTTTGGCCTTG

Full Affymetrix probeset data:

Annotations for 1641092_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720