FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641095_at:

>probe:Drosophila_2:1641095_at:11:431; Interrogation_Position=103; Antisense; GAGTTTGTCAAAAGGCGGCACTTGT
>probe:Drosophila_2:1641095_at:193:257; Interrogation_Position=121; Antisense; CACTTGTCGAGAGGGAGACCCCGGA
>probe:Drosophila_2:1641095_at:670:49; Interrogation_Position=17; Antisense; ATGCGATTCGTACGAACCTTTCCTT
>probe:Drosophila_2:1641095_at:570:11; Interrogation_Position=170; Antisense; ATTCATGCCAATCCGGCAATGGTGT
>probe:Drosophila_2:1641095_at:278:515; Interrogation_Position=191; Antisense; GTGTGCCCACTGATAAGAATCCCTG
>probe:Drosophila_2:1641095_at:586:367; Interrogation_Position=207; Antisense; GAATCCCTGCGACAATTGTACGCAA
>probe:Drosophila_2:1641095_at:476:189; Interrogation_Position=230; Antisense; AACATTGCACTAGTTTGCCACCGGG
>probe:Drosophila_2:1641095_at:167:261; Interrogation_Position=248; Antisense; CACCGGGTGCTGATAATCCTCTAGA
>probe:Drosophila_2:1641095_at:569:71; Interrogation_Position=294; Antisense; AGGCAGAATTGGTTGTCTTCCCTAT
>probe:Drosophila_2:1641095_at:116:357; Interrogation_Position=30; Antisense; GAACCTTTCCTTACACAAGTGCTTT
>probe:Drosophila_2:1641095_at:538:497; Interrogation_Position=308; Antisense; GTCTTCCCTATTGCGGTAGTGATGG
>probe:Drosophila_2:1641095_at:167:395; Interrogation_Position=352; Antisense; GACTATAGCAATATGGACTCGGGTA
>probe:Drosophila_2:1641095_at:704:217; Interrogation_Position=384; Antisense; AAGTAACAGCCACTTGACAATCGAT
>probe:Drosophila_2:1641095_at:25:99; Interrogation_Position=66; Antisense; AGATGACTTTGGCTCGTTTTGGATG

Paste this into a BLAST search page for me
GAGTTTGTCAAAAGGCGGCACTTGTCACTTGTCGAGAGGGAGACCCCGGAATGCGATTCGTACGAACCTTTCCTTATTCATGCCAATCCGGCAATGGTGTGTGTGCCCACTGATAAGAATCCCTGGAATCCCTGCGACAATTGTACGCAAAACATTGCACTAGTTTGCCACCGGGCACCGGGTGCTGATAATCCTCTAGAAGGCAGAATTGGTTGTCTTCCCTATGAACCTTTCCTTACACAAGTGCTTTGTCTTCCCTATTGCGGTAGTGATGGGACTATAGCAATATGGACTCGGGTAAAGTAACAGCCACTTGACAATCGATAGATGACTTTGGCTCGTTTTGGATG

Full Affymetrix probeset data:

Annotations for 1641095_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720