FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641097_at:

>probe:Drosophila_2:1641097_at:72:649; Interrogation_Position=1538; Antisense; TCAGGCGCCTCAATTACGGCAACAA
>probe:Drosophila_2:1641097_at:280:61; Interrogation_Position=1568; Antisense; ATGTCAACGTCACCATCATTGTGGA
>probe:Drosophila_2:1641097_at:248:227; Interrogation_Position=1603; Antisense; AAGGCGGTGATCAACATCGCGCTGG
>probe:Drosophila_2:1641097_at:276:45; Interrogation_Position=1618; Antisense; ATCGCGCTGGATCGTTCAGACAGGA
>probe:Drosophila_2:1641097_at:373:399; Interrogation_Position=1636; Antisense; GACAGGAGCTACTACGCTTGCGATG
>probe:Drosophila_2:1641097_at:154:621; Interrogation_Position=1685; Antisense; TGCTCACGCAAAACCGACGACAATT
>probe:Drosophila_2:1641097_at:677:85; Interrogation_Position=1713; Antisense; AGTCAAACTGACTGAACCGCTAACA
>probe:Drosophila_2:1641097_at:222:355; Interrogation_Position=1782; Antisense; GCACCATGCCATCCACGTGAAGGAA
>probe:Drosophila_2:1641097_at:428:113; Interrogation_Position=1832; Antisense; AGCATTTGATCGCACTGCATCGGCA
>probe:Drosophila_2:1641097_at:356:195; Interrogation_Position=1865; Antisense; AACTGGGTGGATTGCCCACGCTCTT
>probe:Drosophila_2:1641097_at:703:529; Interrogation_Position=1892; Antisense; GGGTTTCCGTGTGCGCAATAATCAT
>probe:Drosophila_2:1641097_at:65:21; Interrogation_Position=1927; Antisense; ATATTCCTGTGCAAGCTCATTATCA
>probe:Drosophila_2:1641097_at:274:225; Interrogation_Position=1951; Antisense; AAGGAGTACTGCGAGCCGAGCGATA
>probe:Drosophila_2:1641097_at:351:217; Interrogation_Position=2064; Antisense; AAGTTCTTCTGCTTTCTGTTACATC

Paste this into a BLAST search page for me
TCAGGCGCCTCAATTACGGCAACAAATGTCAACGTCACCATCATTGTGGAAAGGCGGTGATCAACATCGCGCTGGATCGCGCTGGATCGTTCAGACAGGAGACAGGAGCTACTACGCTTGCGATGTGCTCACGCAAAACCGACGACAATTAGTCAAACTGACTGAACCGCTAACAGCACCATGCCATCCACGTGAAGGAAAGCATTTGATCGCACTGCATCGGCAAACTGGGTGGATTGCCCACGCTCTTGGGTTTCCGTGTGCGCAATAATCATATATTCCTGTGCAAGCTCATTATCAAAGGAGTACTGCGAGCCGAGCGATAAAGTTCTTCTGCTTTCTGTTACATC

Full Affymetrix probeset data:

Annotations for 1641097_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720