Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641098_at:

>probe:Drosophila_2:1641098_at:672:159; Interrogation_Position=1229; Antisense; ACAACACTAGTGATGCCCGAGCATG
>probe:Drosophila_2:1641098_at:660:365; Interrogation_Position=1308; Antisense; GAATCGTTCGCTGGAGGCTTTATCT
>probe:Drosophila_2:1641098_at:127:39; Interrogation_Position=1329; Antisense; ATCTAATCTCTATTCGGATGCCCTG
>probe:Drosophila_2:1641098_at:129:563; Interrogation_Position=1363; Antisense; GGAATCCATCGTTTTGTCCATCTGG
>probe:Drosophila_2:1641098_at:301:573; Interrogation_Position=1386; Antisense; GGCTGCCAGGTCTACGAAGGTCTAC
>probe:Drosophila_2:1641098_at:417:223; Interrogation_Position=1402; Antisense; AAGGTCTACTACTATCGTTTCTCGT
>probe:Drosophila_2:1641098_at:681:683; Interrogation_Position=1414; Antisense; TATCGTTTCTCGTATCAGGGTGCAA
>probe:Drosophila_2:1641098_at:8:361; Interrogation_Position=1435; Antisense; GCAAGGAGTCACATCTATTACCCAG
>probe:Drosophila_2:1641098_at:416:59; Interrogation_Position=1498; Antisense; ATGTATCTGTTTGTGGAACCCTCGA
>probe:Drosophila_2:1641098_at:393:561; Interrogation_Position=1512; Antisense; GGAACCCTCGATAAGTCGCATGTTT
>probe:Drosophila_2:1641098_at:511:687; Interrogation_Position=1569; Antisense; TATTATGGTCCGCATGTTCTCAGCC
>probe:Drosophila_2:1641098_at:340:29; Interrogation_Position=1616; Antisense; ATAAACCCACCGATTTGGCTCTGAG
>probe:Drosophila_2:1641098_at:438:331; Interrogation_Position=1649; Antisense; GCTGGCGACCTTTTAGCTTCAAAAA
>probe:Drosophila_2:1641098_at:225:391; Interrogation_Position=1746; Antisense; GAAACGACTATTTCCGCTCAACTGG

Paste this into a BLAST search page for me
ACAACACTAGTGATGCCCGAGCATGGAATCGTTCGCTGGAGGCTTTATCTATCTAATCTCTATTCGGATGCCCTGGGAATCCATCGTTTTGTCCATCTGGGGCTGCCAGGTCTACGAAGGTCTACAAGGTCTACTACTATCGTTTCTCGTTATCGTTTCTCGTATCAGGGTGCAAGCAAGGAGTCACATCTATTACCCAGATGTATCTGTTTGTGGAACCCTCGAGGAACCCTCGATAAGTCGCATGTTTTATTATGGTCCGCATGTTCTCAGCCATAAACCCACCGATTTGGCTCTGAGGCTGGCGACCTTTTAGCTTCAAAAAGAAACGACTATTTCCGCTCAACTGG

Full Affymetrix probeset data:

Annotations for 1641098_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime