Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641100_at:

>probe:Drosophila_2:1641100_at:398:569; Interrogation_Position=2819; Antisense; TGGCTTTAGAGGACCCGGCGGACCT
>probe:Drosophila_2:1641100_at:273:517; Interrogation_Position=2860; Antisense; GTGGTGCCTGGAAGGGCTTTCCTAC
>probe:Drosophila_2:1641100_at:292:277; Interrogation_Position=2877; Antisense; TTTCCTACCGCAGCCGTCGGAAAGG
>probe:Drosophila_2:1641100_at:726:45; Interrogation_Position=2933; Antisense; ATCCGAACCTATACCAGTACGCTAT
>probe:Drosophila_2:1641100_at:611:487; Interrogation_Position=2949; Antisense; GTACGCTATCCGAAGAGATTCCTCA
>probe:Drosophila_2:1641100_at:229:53; Interrogation_Position=3070; Antisense; AGAAGGGTACTCTGGTCCGTCCCTG
>probe:Drosophila_2:1641100_at:526:395; Interrogation_Position=3114; Antisense; GACAAAAGACCTAGACCACCCAAAG
>probe:Drosophila_2:1641100_at:435:341; Interrogation_Position=3142; Antisense; GCTTTGTCGGAGACGATGGCCTAAA
>probe:Drosophila_2:1641100_at:662:561; Interrogation_Position=3178; Antisense; GGAAGCGCAAAATGCTCCTGGCCGT
>probe:Drosophila_2:1641100_at:202:469; Interrogation_Position=3201; Antisense; GTTCCACCAATACCAATCACTGAGA
>probe:Drosophila_2:1641100_at:550:559; Interrogation_Position=3237; Antisense; GGAAAAGCACCCAATCCCTGTGATC
>probe:Drosophila_2:1641100_at:322:305; Interrogation_Position=3253; Antisense; CCTGTGATCCCTATCGCATGGATAT
>probe:Drosophila_2:1641100_at:74:229; Interrogation_Position=3287; Antisense; AATGGTCTTCATTGTCTGCATTCAT
>probe:Drosophila_2:1641100_at:514:499; Interrogation_Position=3300; Antisense; GTCTGCATTCATTTCAATATCGCTA

Paste this into a BLAST search page for me
TGGCTTTAGAGGACCCGGCGGACCTGTGGTGCCTGGAAGGGCTTTCCTACTTTCCTACCGCAGCCGTCGGAAAGGATCCGAACCTATACCAGTACGCTATGTACGCTATCCGAAGAGATTCCTCAAGAAGGGTACTCTGGTCCGTCCCTGGACAAAAGACCTAGACCACCCAAAGGCTTTGTCGGAGACGATGGCCTAAAGGAAGCGCAAAATGCTCCTGGCCGTGTTCCACCAATACCAATCACTGAGAGGAAAAGCACCCAATCCCTGTGATCCCTGTGATCCCTATCGCATGGATATAATGGTCTTCATTGTCTGCATTCATGTCTGCATTCATTTCAATATCGCTA

Full Affymetrix probeset data:

Annotations for 1641100_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime