Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641101_at:

>probe:Drosophila_2:1641101_at:663:227; Interrogation_Position=221; Antisense; AATGGAACGATGTGCCTATGTCGGA
>probe:Drosophila_2:1641101_at:651:203; Interrogation_Position=279; Antisense; AACCAAGGATATGGCCATGCTGCAA
>probe:Drosophila_2:1641101_at:167:359; Interrogation_Position=300; Antisense; GCAAGAAGCCCTAAATTCGACCGTA
>probe:Drosophila_2:1641101_at:85:301; Interrogation_Position=335; Antisense; CGCCGCTAGCGATTTCTGATGATAT
>probe:Drosophila_2:1641101_at:697:385; Interrogation_Position=496; Antisense; GAAAATAAACCGGAGCCTGTGATTC
>probe:Drosophila_2:1641101_at:178:555; Interrogation_Position=507; Antisense; GGAGCCTGTGATTCCAGACGCCGAA
>probe:Drosophila_2:1641101_at:688:409; Interrogation_Position=523; Antisense; GACGCCGAACCTCGAGAAGATTCCG
>probe:Drosophila_2:1641101_at:619:529; Interrogation_Position=560; Antisense; GGGTGCGATTTGCTCTAACAGATCA
>probe:Drosophila_2:1641101_at:339:187; Interrogation_Position=576; Antisense; AACAGATCAGGGAAAACCAGCCAAA
>probe:Drosophila_2:1641101_at:519:355; Interrogation_Position=612; Antisense; GCACATTAATATAGCGAAACCCACG
>probe:Drosophila_2:1641101_at:635:391; Interrogation_Position=627; Antisense; GAAACCCACGAAGATTATAGCTGAA
>probe:Drosophila_2:1641101_at:493:683; Interrogation_Position=678; Antisense; TATGCGTAAACGGTCATCTCCTTCA
>probe:Drosophila_2:1641101_at:188:291; Interrogation_Position=688; Antisense; CGGTCATCTCCTTCAAACACGAAAA
>probe:Drosophila_2:1641101_at:267:133; Interrogation_Position=704; Antisense; ACACGAAAACGGGATGGAAGCTCTA

Paste this into a BLAST search page for me
AATGGAACGATGTGCCTATGTCGGAAACCAAGGATATGGCCATGCTGCAAGCAAGAAGCCCTAAATTCGACCGTACGCCGCTAGCGATTTCTGATGATATGAAAATAAACCGGAGCCTGTGATTCGGAGCCTGTGATTCCAGACGCCGAAGACGCCGAACCTCGAGAAGATTCCGGGGTGCGATTTGCTCTAACAGATCAAACAGATCAGGGAAAACCAGCCAAAGCACATTAATATAGCGAAACCCACGGAAACCCACGAAGATTATAGCTGAATATGCGTAAACGGTCATCTCCTTCACGGTCATCTCCTTCAAACACGAAAAACACGAAAACGGGATGGAAGCTCTA

Full Affymetrix probeset data:

Annotations for 1641101_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime