FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641102_at:

>probe:Drosophila_2:1641102_at:712:45; Interrogation_Position=315; Antisense; ATCCGGAGTCCGATCAGTACTACAA
>probe:Drosophila_2:1641102_at:725:203; Interrogation_Position=366; Antisense; AAGCCTCGCACTTCGATCTTGAGTA
>probe:Drosophila_2:1641102_at:618:35; Interrogation_Position=381; Antisense; ATCTTGAGTACGTTCTGGGCCACAA
>probe:Drosophila_2:1641102_at:267:159; Interrogation_Position=402; Antisense; ACAAGATCGCCTTTTTGTGCGTGGC
>probe:Drosophila_2:1641102_at:114:411; Interrogation_Position=441; Antisense; GACCCCATATCACCTGGTACAAGGA
>probe:Drosophila_2:1641102_at:276:121; Interrogation_Position=469; Antisense; AGCGGAGATCTATCAGCACCTCTAT
>probe:Drosophila_2:1641102_at:173:355; Interrogation_Position=484; Antisense; GCACCTCTATATGCACGTACACGAA
>probe:Drosophila_2:1641102_at:556:135; Interrogation_Position=504; Antisense; ACGAATGGCGCATCGGCGACGACAA
>probe:Drosophila_2:1641102_at:441:375; Interrogation_Position=538; Antisense; GAAGATCGAAATTGACCCTGCCACA
>probe:Drosophila_2:1641102_at:662:583; Interrogation_Position=567; Antisense; TGGACGCTGGACTCTACGAATGCAC
>probe:Drosophila_2:1641102_at:23:399; Interrogation_Position=596; Antisense; GACAACATGTACTCCATCGATCGGC
>probe:Drosophila_2:1641102_at:169:41; Interrogation_Position=611; Antisense; ATCGATCGGCGCAGTTTTAAGACGG
>probe:Drosophila_2:1641102_at:228:657; Interrogation_Position=628; Antisense; TAAGACGGATTTCTCCATTGCCTTC
>probe:Drosophila_2:1641102_at:146:9; Interrogation_Position=644; Antisense; ATTGCCTTCGACTGATCGCAACAAA

Paste this into a BLAST search page for me
ATCCGGAGTCCGATCAGTACTACAAAAGCCTCGCACTTCGATCTTGAGTAATCTTGAGTACGTTCTGGGCCACAAACAAGATCGCCTTTTTGTGCGTGGCGACCCCATATCACCTGGTACAAGGAAGCGGAGATCTATCAGCACCTCTATGCACCTCTATATGCACGTACACGAAACGAATGGCGCATCGGCGACGACAAGAAGATCGAAATTGACCCTGCCACATGGACGCTGGACTCTACGAATGCACGACAACATGTACTCCATCGATCGGCATCGATCGGCGCAGTTTTAAGACGGTAAGACGGATTTCTCCATTGCCTTCATTGCCTTCGACTGATCGCAACAAA

Full Affymetrix probeset data:

Annotations for 1641102_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720