FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641103_at:

>probe:Drosophila_2:1641103_at:129:115; Interrogation_Position=273; Antisense; AGCAGACCCTCCAGCTTTATGAGGA
>probe:Drosophila_2:1641103_at:306:379; Interrogation_Position=343; Antisense; GAACCTGAGTATGGAGCGCTTGATG
>probe:Drosophila_2:1641103_at:629:441; Interrogation_Position=364; Antisense; GATGGTGGACCTGCGAGACTACAAC
>probe:Drosophila_2:1641103_at:508:325; Interrogation_Position=376; Antisense; GCGAGACTACAACATCCACTTGATC
>probe:Drosophila_2:1641103_at:506:325; Interrogation_Position=402; Antisense; GCGAAAACTATATGCTGTCCGTGAT
>probe:Drosophila_2:1641103_at:594:385; Interrogation_Position=431; Antisense; GAACAGAAACCAAGGCCGGCCGAGC
>probe:Drosophila_2:1641103_at:146:39; Interrogation_Position=486; Antisense; ATCTCACTCGCCAGATGTTTCTGAA
>probe:Drosophila_2:1641103_at:449:237; Interrogation_Position=524; Antisense; AATCTGAACGTCCATGACCATGGCG
>probe:Drosophila_2:1641103_at:710:23; Interrogation_Position=612; Antisense; ATATGAGCCCGATTGCCGATCCGAA
>probe:Drosophila_2:1641103_at:563:363; Interrogation_Position=634; Antisense; GAATTCGATAGATCCCAGCAGCACC
>probe:Drosophila_2:1641103_at:330:261; Interrogation_Position=658; Antisense; CACCAAGCAGATTCTCCCAATTGTT
>probe:Drosophila_2:1641103_at:461:301; Interrogation_Position=673; Antisense; CCCAATTGTTATGAGCACCGAGCAG
>probe:Drosophila_2:1641103_at:329:261; Interrogation_Position=688; Antisense; CACCGAGCAGTTGGCCGAATTGCAA
>probe:Drosophila_2:1641103_at:425:247; Interrogation_Position=808; Antisense; AATTGCTCTACTTTTCCATTGTTTT

Paste this into a BLAST search page for me
AGCAGACCCTCCAGCTTTATGAGGAGAACCTGAGTATGGAGCGCTTGATGGATGGTGGACCTGCGAGACTACAACGCGAGACTACAACATCCACTTGATCGCGAAAACTATATGCTGTCCGTGATGAACAGAAACCAAGGCCGGCCGAGCATCTCACTCGCCAGATGTTTCTGAAAATCTGAACGTCCATGACCATGGCGATATGAGCCCGATTGCCGATCCGAAGAATTCGATAGATCCCAGCAGCACCCACCAAGCAGATTCTCCCAATTGTTCCCAATTGTTATGAGCACCGAGCAGCACCGAGCAGTTGGCCGAATTGCAAAATTGCTCTACTTTTCCATTGTTTT

Full Affymetrix probeset data:

Annotations for 1641103_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720