FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641105_at:

>probe:Drosophila_2:1641105_at:380:711; Interrogation_Position=466; Antisense; TTGTTATCAAACTCGGTTCCGTCAC
>probe:Drosophila_2:1641105_at:123:471; Interrogation_Position=481; Antisense; GTTCCGTCACCATGATGGAGCACTT
>probe:Drosophila_2:1641105_at:33:223; Interrogation_Position=507; Antisense; AAGGGCATCCTCATCGAAATCGAGT
>probe:Drosophila_2:1641105_at:339:161; Interrogation_Position=532; Antisense; ACAAGTCATGCGTGATTCTGGCCTA
>probe:Drosophila_2:1641105_at:96:641; Interrogation_Position=548; Antisense; TCTGGCCTACTGCTGGGAAATGATA
>probe:Drosophila_2:1641105_at:354:543; Interrogation_Position=588; Antisense; GGATTCCTCGGCATTGCTGTGAATA
>probe:Drosophila_2:1641105_at:258:509; Interrogation_Position=606; Antisense; GTGAATAAGGACTTTCCCTCCTATT
>probe:Drosophila_2:1641105_at:455:347; Interrogation_Position=674; Antisense; GCATGCCAAGCACAACGACATCTTT
>probe:Drosophila_2:1641105_at:371:27; Interrogation_Position=722; Antisense; ATACCTGGAGCAGTTCACCAACTAT
>probe:Drosophila_2:1641105_at:600:115; Interrogation_Position=751; Antisense; AGCATGTGACTCTTATGGGCGGTAT
>probe:Drosophila_2:1641105_at:664:253; Interrogation_Position=795; Antisense; CAACAGGTTGGTCCGAACGTGCATA
>probe:Drosophila_2:1641105_at:561:517; Interrogation_Position=831; Antisense; GTGGCGGGACTACATCGATCCTGAT
>probe:Drosophila_2:1641105_at:292:139; Interrogation_Position=862; Antisense; ACGTCAAGCTGGAGCCACCGGATGA
>probe:Drosophila_2:1641105_at:498:415; Interrogation_Position=885; Antisense; GAGCCTGCAGCCGATTAAGATGTTT

Paste this into a BLAST search page for me
TTGTTATCAAACTCGGTTCCGTCACGTTCCGTCACCATGATGGAGCACTTAAGGGCATCCTCATCGAAATCGAGTACAAGTCATGCGTGATTCTGGCCTATCTGGCCTACTGCTGGGAAATGATAGGATTCCTCGGCATTGCTGTGAATAGTGAATAAGGACTTTCCCTCCTATTGCATGCCAAGCACAACGACATCTTTATACCTGGAGCAGTTCACCAACTATAGCATGTGACTCTTATGGGCGGTATCAACAGGTTGGTCCGAACGTGCATAGTGGCGGGACTACATCGATCCTGATACGTCAAGCTGGAGCCACCGGATGAGAGCCTGCAGCCGATTAAGATGTTT

Full Affymetrix probeset data:

Annotations for 1641105_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720