Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641107_at:

>probe:Drosophila_2:1641107_at:694:693; Interrogation_Position=1620; Antisense; TTTGCAGCGGCACCAGTTGCTGATA
>probe:Drosophila_2:1641107_at:488:447; Interrogation_Position=1705; Antisense; GATGCCCATATGAACACGGAGACTT
>probe:Drosophila_2:1641107_at:717:447; Interrogation_Position=1759; Antisense; GATCCATCCTACATATACTCAACTG
>probe:Drosophila_2:1641107_at:548:665; Interrogation_Position=1774; Antisense; TACTCAACTGCCTACCAGGAATCAG
>probe:Drosophila_2:1641107_at:10:629; Interrogation_Position=1817; Antisense; TCCAAGCCTACCATGAGCAGCAGAA
>probe:Drosophila_2:1641107_at:68:431; Interrogation_Position=1855; Antisense; GAGTCGCATACCACGGCAGTTGAGC
>probe:Drosophila_2:1641107_at:472:119; Interrogation_Position=1877; Antisense; AGCTGCAGCAAAGATTTCTCCTTCC
>probe:Drosophila_2:1641107_at:633:481; Interrogation_Position=1911; Antisense; GTATTGCCAATCCAGCAGCAGGACC
>probe:Drosophila_2:1641107_at:336:473; Interrogation_Position=1945; Antisense; GTTAGTCCCTCTGCCCGGAAAGTGA
>probe:Drosophila_2:1641107_at:594:467; Interrogation_Position=1973; Antisense; GTTGTCGCACAAGGATTTCTGAGCT
>probe:Drosophila_2:1641107_at:587:193; Interrogation_Position=2001; Antisense; AACGGATCCGTATCCTTGCCAAATA
>probe:Drosophila_2:1641107_at:607:719; Interrogation_Position=2016; Antisense; TTGCCAAATAAGAACTCCCTTGCCG
>probe:Drosophila_2:1641107_at:64:417; Interrogation_Position=2092; Antisense; GAGCCCAGAAACGACCATTTCGGAA
>probe:Drosophila_2:1641107_at:654:503; Interrogation_Position=2130; Antisense; GTCCAACTACGTGGCTAGCTTTATG

Paste this into a BLAST search page for me
TTTGCAGCGGCACCAGTTGCTGATAGATGCCCATATGAACACGGAGACTTGATCCATCCTACATATACTCAACTGTACTCAACTGCCTACCAGGAATCAGTCCAAGCCTACCATGAGCAGCAGAAGAGTCGCATACCACGGCAGTTGAGCAGCTGCAGCAAAGATTTCTCCTTCCGTATTGCCAATCCAGCAGCAGGACCGTTAGTCCCTCTGCCCGGAAAGTGAGTTGTCGCACAAGGATTTCTGAGCTAACGGATCCGTATCCTTGCCAAATATTGCCAAATAAGAACTCCCTTGCCGGAGCCCAGAAACGACCATTTCGGAAGTCCAACTACGTGGCTAGCTTTATG

Full Affymetrix probeset data:

Annotations for 1641107_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime