FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641108_at:

>probe:Drosophila_2:1641108_at:252:59; Interrogation_Position=1007; Antisense; ATGATCCACGTATTCTACACGATGG
>probe:Drosophila_2:1641108_at:681:219; Interrogation_Position=1102; Antisense; AAGTGGTCGGATCTTCTGGTGCTCA
>probe:Drosophila_2:1641108_at:10:511; Interrogation_Position=1136; Antisense; GTGAGCATGCTTTGCATCACCTATT
>probe:Drosophila_2:1641108_at:347:689; Interrogation_Position=1157; Antisense; TATTTCCCACACTGGATCATGGAGT
>probe:Drosophila_2:1641108_at:99:509; Interrogation_Position=1180; Antisense; GTGCTAAAGCATCTGTATCCTGAGT
>probe:Drosophila_2:1641108_at:148:377; Interrogation_Position=1299; Antisense; GAAGAATCCAATTCCGCCGGGTAGT
>probe:Drosophila_2:1641108_at:677:725; Interrogation_Position=760; Antisense; TTGATCTCAGTGGTTATCAGCCCCG
>probe:Drosophila_2:1641108_at:105:35; Interrogation_Position=775; Antisense; ATCAGCCCCGTGGTATATGTGGTCT
>probe:Drosophila_2:1641108_at:724:601; Interrogation_Position=800; Antisense; TGTTCCAAGGGCAGTTTCTCATACG
>probe:Drosophila_2:1641108_at:629:197; Interrogation_Position=850; Antisense; AACGTTCTGTGCTGGGATGATCTCA
>probe:Drosophila_2:1641108_at:51:445; Interrogation_Position=865; Antisense; GATGATCTCATTGGCTTCAGTCTGC
>probe:Drosophila_2:1641108_at:576:683; Interrogation_Position=905; Antisense; TATCCACTGGTGTTAGCCTGTTGAG
>probe:Drosophila_2:1641108_at:665:637; Interrogation_Position=958; Antisense; TCGGTTGGGAGCTTTATCTTCGGAC
>probe:Drosophila_2:1641108_at:317:37; Interrogation_Position=973; Antisense; ATCTTCGGACTTGTTGGTCTCACTG

Paste this into a BLAST search page for me
ATGATCCACGTATTCTACACGATGGAAGTGGTCGGATCTTCTGGTGCTCAGTGAGCATGCTTTGCATCACCTATTTATTTCCCACACTGGATCATGGAGTGTGCTAAAGCATCTGTATCCTGAGTGAAGAATCCAATTCCGCCGGGTAGTTTGATCTCAGTGGTTATCAGCCCCGATCAGCCCCGTGGTATATGTGGTCTTGTTCCAAGGGCAGTTTCTCATACGAACGTTCTGTGCTGGGATGATCTCAGATGATCTCATTGGCTTCAGTCTGCTATCCACTGGTGTTAGCCTGTTGAGTCGGTTGGGAGCTTTATCTTCGGACATCTTCGGACTTGTTGGTCTCACTG

Full Affymetrix probeset data:

Annotations for 1641108_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720