FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641109_at:

>probe:Drosophila_2:1641109_at:668:301; Interrogation_Position=1114; Antisense; CCCCGCTGATTGTCGCCATTAAAAA
>probe:Drosophila_2:1641109_at:429:267; Interrogation_Position=559; Antisense; CAGGCATCTGCGATAAGTTCTACTT
>probe:Drosophila_2:1641109_at:629:91; Interrogation_Position=574; Antisense; AGTTCTACTTTTGCGTGGATGGTCA
>probe:Drosophila_2:1641109_at:351:93; Interrogation_Position=598; Antisense; AGTTCAATATGATTACCTGCCCGGC
>probe:Drosophila_2:1641109_at:515:331; Interrogation_Position=621; Antisense; GCTGGACTGGTCTTCAATCCCAAGA
>probe:Drosophila_2:1641109_at:488:569; Interrogation_Position=648; Antisense; GGCATATGTGGCTGGCCTGACCAAG
>probe:Drosophila_2:1641109_at:477:61; Interrogation_Position=700; Antisense; ATGTCTTCGACTTTGAGTGCCCCAA
>probe:Drosophila_2:1641109_at:117:137; Interrogation_Position=730; Antisense; ACGAGAGCATCGCAGTGACACATCC
>probe:Drosophila_2:1641109_at:37:199; Interrogation_Position=771; Antisense; AACGATTGCCAGTTCTTCTACGTCT
>probe:Drosophila_2:1641109_at:559:651; Interrogation_Position=799; Antisense; TCAACGGAGATCTGCCCAGGCGAAA
>probe:Drosophila_2:1641109_at:44:257; Interrogation_Position=830; Antisense; CAAACTGGGCCAGGTCTTCGACGAG
>probe:Drosophila_2:1641109_at:234:225; Interrogation_Position=858; Antisense; AAGGAGACCTGCGACTGGGCACGCA
>probe:Drosophila_2:1641109_at:385:259; Interrogation_Position=877; Antisense; CACGCAAGGTGCCAGATTGTGCCGA
>probe:Drosophila_2:1641109_at:487:537; Interrogation_Position=904; Antisense; GGTACAAGGATCGTCTGACCGACAA

Paste this into a BLAST search page for me
CCCCGCTGATTGTCGCCATTAAAAACAGGCATCTGCGATAAGTTCTACTTAGTTCTACTTTTGCGTGGATGGTCAAGTTCAATATGATTACCTGCCCGGCGCTGGACTGGTCTTCAATCCCAAGAGGCATATGTGGCTGGCCTGACCAAGATGTCTTCGACTTTGAGTGCCCCAAACGAGAGCATCGCAGTGACACATCCAACGATTGCCAGTTCTTCTACGTCTTCAACGGAGATCTGCCCAGGCGAAACAAACTGGGCCAGGTCTTCGACGAGAAGGAGACCTGCGACTGGGCACGCACACGCAAGGTGCCAGATTGTGCCGAGGTACAAGGATCGTCTGACCGACAA

Full Affymetrix probeset data:

Annotations for 1641109_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720