Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641112_at:

>probe:Drosophila_2:1641112_at:432:155; Interrogation_Position=289; Antisense; ACACGACCTCCTCAGAAGCAGAAAG
>probe:Drosophila_2:1641112_at:150:101; Interrogation_Position=338; Antisense; AGAGACTTTCAATGCAGGACCTATT
>probe:Drosophila_2:1641112_at:725:73; Interrogation_Position=353; Antisense; AGGACCTATTGCTGATGCCCGGAAT
>probe:Drosophila_2:1641112_at:669:425; Interrogation_Position=382; Antisense; GAGAGCTCCCCAATTGTCGACCAGG
>probe:Drosophila_2:1641112_at:187:645; Interrogation_Position=440; Antisense; TCTACCCTGTTCCATTTTATATTCC
>probe:Drosophila_2:1641112_at:601:697; Interrogation_Position=456; Antisense; TTATATTCCGTATCCGATGCCCTTA
>probe:Drosophila_2:1641112_at:430:447; Interrogation_Position=471; Antisense; GATGCCCTTAATGCTGAATCCACAG
>probe:Drosophila_2:1641112_at:427:389; Interrogation_Position=584; Antisense; GAAACTCTTTTCAGCAGGACAACGG
>probe:Drosophila_2:1641112_at:65:75; Interrogation_Position=599; Antisense; AGGACAACGGGTCTGATTGGCACAA
>probe:Drosophila_2:1641112_at:541:367; Interrogation_Position=633; Antisense; GAATCGAGTGAAGCCGGTCAGCCAA
>probe:Drosophila_2:1641112_at:218:325; Interrogation_Position=687; Antisense; GCGAAAGACAACGACCACTACTACT
>probe:Drosophila_2:1641112_at:177:379; Interrogation_Position=727; Antisense; GAAGCTCCTATTACAATGTCAACTG
>probe:Drosophila_2:1641112_at:532:415; Interrogation_Position=751; Antisense; GAGCCAACAAGATTGCTGTCGGATA
>probe:Drosophila_2:1641112_at:702:185; Interrogation_Position=823; Antisense; AACAATGAGACAACTGCTGCCGCAA

Paste this into a BLAST search page for me
ACACGACCTCCTCAGAAGCAGAAAGAGAGACTTTCAATGCAGGACCTATTAGGACCTATTGCTGATGCCCGGAATGAGAGCTCCCCAATTGTCGACCAGGTCTACCCTGTTCCATTTTATATTCCTTATATTCCGTATCCGATGCCCTTAGATGCCCTTAATGCTGAATCCACAGGAAACTCTTTTCAGCAGGACAACGGAGGACAACGGGTCTGATTGGCACAAGAATCGAGTGAAGCCGGTCAGCCAAGCGAAAGACAACGACCACTACTACTGAAGCTCCTATTACAATGTCAACTGGAGCCAACAAGATTGCTGTCGGATAAACAATGAGACAACTGCTGCCGCAA

Full Affymetrix probeset data:

Annotations for 1641112_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime