FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641113_at:

>probe:Drosophila_2:1641113_at:216:125; Interrogation_Position=279; Antisense; AGCCACGGCCTCTGGAGTGGGAAAT
>probe:Drosophila_2:1641113_at:539:399; Interrogation_Position=306; Antisense; GACAGCCATTGTTAACGCAATCCAG
>probe:Drosophila_2:1641113_at:317:167; Interrogation_Position=435; Antisense; AAATGAAGTGGCCTCATCCGTCAAC
>probe:Drosophila_2:1641113_at:691:117; Interrogation_Position=482; Antisense; AGCTGCTATCACAGGCCGTCATAGG
>probe:Drosophila_2:1641113_at:465:29; Interrogation_Position=527; Antisense; ATAAAGCGAAGGTCCTCCAGGAGCA
>probe:Drosophila_2:1641113_at:120:113; Interrogation_Position=551; Antisense; AGCAGCGCAACATCGTGGGTCAATC
>probe:Drosophila_2:1641113_at:576:517; Interrogation_Position=565; Antisense; GTGGGTCAATCCGAGAGCCTCAACA
>probe:Drosophila_2:1641113_at:65:117; Interrogation_Position=589; Antisense; AGCATCGAGCACACTGTCCATGGAG
>probe:Drosophila_2:1641113_at:669:535; Interrogation_Position=633; Antisense; GGTCGATCATAAACTGGCTGCCCTA
>probe:Drosophila_2:1641113_at:687:287; Interrogation_Position=646; Antisense; CTGGCTGCCCTACTGAACAATCAGA
>probe:Drosophila_2:1641113_at:690:409; Interrogation_Position=684; Antisense; GACGCTGGATGGCTGCAAGCACAAA
>probe:Drosophila_2:1641113_at:359:209; Interrogation_Position=700; Antisense; AAGCACAAAAATCCGTCACACCAGA
>probe:Drosophila_2:1641113_at:202:109; Interrogation_Position=722; Antisense; AGAAGCCCCACGAGATCTGGACTCA
>probe:Drosophila_2:1641113_at:438:423; Interrogation_Position=799; Antisense; GAGAACGTCTATGCATCCCAAGAAG

Paste this into a BLAST search page for me
AGCCACGGCCTCTGGAGTGGGAAATGACAGCCATTGTTAACGCAATCCAGAAATGAAGTGGCCTCATCCGTCAACAGCTGCTATCACAGGCCGTCATAGGATAAAGCGAAGGTCCTCCAGGAGCAAGCAGCGCAACATCGTGGGTCAATCGTGGGTCAATCCGAGAGCCTCAACAAGCATCGAGCACACTGTCCATGGAGGGTCGATCATAAACTGGCTGCCCTACTGGCTGCCCTACTGAACAATCAGAGACGCTGGATGGCTGCAAGCACAAAAAGCACAAAAATCCGTCACACCAGAAGAAGCCCCACGAGATCTGGACTCAGAGAACGTCTATGCATCCCAAGAAG

Full Affymetrix probeset data:

Annotations for 1641113_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720