FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641115_at:

>probe:Drosophila_2:1641115_at:653:135; Interrogation_Position=1818; Antisense; ACGAAGACGACAGCAGTTCTTCCAC
>probe:Drosophila_2:1641115_at:233:159; Interrogation_Position=1841; Antisense; ACAACCACCAGTAGCGAGGCGGAGG
>probe:Drosophila_2:1641115_at:85:391; Interrogation_Position=1866; Antisense; GAAACAGCGTCATCGAGCAGTGCAG
>probe:Drosophila_2:1641115_at:12:353; Interrogation_Position=1887; Antisense; GCAGCAACAGTGAGACAGCAGCCAG
>probe:Drosophila_2:1641115_at:45:355; Interrogation_Position=1904; Antisense; GCAGCCAGCACCACATAAATTGCCA
>probe:Drosophila_2:1641115_at:515:161; Interrogation_Position=1920; Antisense; AAATTGCCACTTATGTCGAGTTCGG
>probe:Drosophila_2:1641115_at:411:703; Interrogation_Position=1930; Antisense; TTATGTCGAGTTCGGCAAGTCCTGC
>probe:Drosophila_2:1641115_at:500:631; Interrogation_Position=1955; Antisense; TCCTGCCTTGCCCAAAACAAACAAG
>probe:Drosophila_2:1641115_at:525:381; Interrogation_Position=2004; Antisense; GAACGGAGGCTAAACAGTGATTACT
>probe:Drosophila_2:1641115_at:152:215; Interrogation_Position=2164; Antisense; AAGATTTGTTCACGCCAAATGCGAA
>probe:Drosophila_2:1641115_at:20:615; Interrogation_Position=2197; Antisense; TGAATATTTTTTCCCCTTTGCTCTA
>probe:Drosophila_2:1641115_at:129:693; Interrogation_Position=2213; Antisense; TTTGCTCTACAATTACTTCGATTAT
>probe:Drosophila_2:1641115_at:395:387; Interrogation_Position=2315; Antisense; GAAAAGCGAAATCTAGTTGTGCATT
>probe:Drosophila_2:1641115_at:57:637; Interrogation_Position=2354; Antisense; TCGATATTGTTGGTGCTGCAAGCAA

Paste this into a BLAST search page for me
ACGAAGACGACAGCAGTTCTTCCACACAACCACCAGTAGCGAGGCGGAGGGAAACAGCGTCATCGAGCAGTGCAGGCAGCAACAGTGAGACAGCAGCCAGGCAGCCAGCACCACATAAATTGCCAAAATTGCCACTTATGTCGAGTTCGGTTATGTCGAGTTCGGCAAGTCCTGCTCCTGCCTTGCCCAAAACAAACAAGGAACGGAGGCTAAACAGTGATTACTAAGATTTGTTCACGCCAAATGCGAATGAATATTTTTTCCCCTTTGCTCTATTTGCTCTACAATTACTTCGATTATGAAAAGCGAAATCTAGTTGTGCATTTCGATATTGTTGGTGCTGCAAGCAA

Full Affymetrix probeset data:

Annotations for 1641115_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720