FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641116_at:

>probe:Drosophila_2:1641116_at:197:27; Interrogation_Position=1083; Antisense; ATACGCTAAGACTCGAACAACGTCA
>probe:Drosophila_2:1641116_at:123:575; Interrogation_Position=588; Antisense; GGCCGATCAGGTGCAAGCAGCTATA
>probe:Drosophila_2:1641116_at:135:533; Interrogation_Position=663; Antisense; GGTGGACGCGACAGCAGCCGCTACA
>probe:Drosophila_2:1641116_at:82:155; Interrogation_Position=685; Antisense; ACAGCAGCGGAAGTAGCGCCAGCTA
>probe:Drosophila_2:1641116_at:227:97; Interrogation_Position=705; Antisense; AGCTACGGACGCACTGGTGGTCAGT
>probe:Drosophila_2:1641116_at:343:485; Interrogation_Position=724; Antisense; GTCAGTCGGCCGGACGCTTCAGGTC
>probe:Drosophila_2:1641116_at:273:635; Interrogation_Position=753; Antisense; TCGCCGGTGGGAAACCATCGATTCT
>probe:Drosophila_2:1641116_at:369:43; Interrogation_Position=769; Antisense; ATCGATTCTAATGACAACACCACTC
>probe:Drosophila_2:1641116_at:102:189; Interrogation_Position=784; Antisense; AACACCACTCATAGTTGCTTAAGGA
>probe:Drosophila_2:1641116_at:582:659; Interrogation_Position=842; Antisense; TAAGCGCGACCGTAAAACGCAGACT
>probe:Drosophila_2:1641116_at:379:237; Interrogation_Position=878; Antisense; AATCGTAGCATTCGATCGTTTTCGA
>probe:Drosophila_2:1641116_at:689:41; Interrogation_Position=892; Antisense; ATCGTTTTCGATCGTCCAACAGATT
>probe:Drosophila_2:1641116_at:132:179; Interrogation_Position=976; Antisense; AAACTGATAGTCGTCGTCTCTTCAT
>probe:Drosophila_2:1641116_at:465:501; Interrogation_Position=985; Antisense; GTCGTCGTCTCTTCATTATTTATTT

Paste this into a BLAST search page for me
ATACGCTAAGACTCGAACAACGTCAGGCCGATCAGGTGCAAGCAGCTATAGGTGGACGCGACAGCAGCCGCTACAACAGCAGCGGAAGTAGCGCCAGCTAAGCTACGGACGCACTGGTGGTCAGTGTCAGTCGGCCGGACGCTTCAGGTCTCGCCGGTGGGAAACCATCGATTCTATCGATTCTAATGACAACACCACTCAACACCACTCATAGTTGCTTAAGGATAAGCGCGACCGTAAAACGCAGACTAATCGTAGCATTCGATCGTTTTCGAATCGTTTTCGATCGTCCAACAGATTAAACTGATAGTCGTCGTCTCTTCATGTCGTCGTCTCTTCATTATTTATTT

Full Affymetrix probeset data:

Annotations for 1641116_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720