FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641118_at:

>probe:Drosophila_2:1641118_at:141:669; Interrogation_Position=2748; Antisense; TACTAACTCTGACGGCGGCATCAAG
>probe:Drosophila_2:1641118_at:28:333; Interrogation_Position=2762; Antisense; GCGGCATCAAGCGAGCTCTGAAGCT
>probe:Drosophila_2:1641118_at:196:711; Interrogation_Position=2810; Antisense; TTAATCACAATCCACCCGAAATTCG
>probe:Drosophila_2:1641118_at:160:691; Interrogation_Position=2853; Antisense; TATTGCTATATGCTCCTTTCGTTCA
>probe:Drosophila_2:1641118_at:81:629; Interrogation_Position=2866; Antisense; TCCTTTCGTTCACACACAGAGAGCG
>probe:Drosophila_2:1641118_at:57:251; Interrogation_Position=2924; Antisense; CAAACCGACCGCCTAGAACAATTGG
>probe:Drosophila_2:1641118_at:598:491; Interrogation_Position=3036; Antisense; GTAAAACAACTTAACTCGCTGCCGT
>probe:Drosophila_2:1641118_at:85:475; Interrogation_Position=3059; Antisense; GTTAACCACCACCAACTATCTAAGT
>probe:Drosophila_2:1641118_at:396:385; Interrogation_Position=3086; Antisense; GAACATTATGCTTTCTATCGATTAG
>probe:Drosophila_2:1641118_at:586:293; Interrogation_Position=3139; Antisense; CGACGATTATGTTTGTTGTTTAGCC
>probe:Drosophila_2:1641118_at:219:537; Interrogation_Position=3219; Antisense; GGTCGAGCCTAATGTATCAGTAACT
>probe:Drosophila_2:1641118_at:365:659; Interrogation_Position=3252; Antisense; TAACCCCTTATGATCGATCGGACCG
>probe:Drosophila_2:1641118_at:146:451; Interrogation_Position=3267; Antisense; GATCGGACCGATTCAGCCATTGTAC
>probe:Drosophila_2:1641118_at:702:313; Interrogation_Position=3282; Antisense; GCCATTGTACCACTGACTAGATGAT

Paste this into a BLAST search page for me
TACTAACTCTGACGGCGGCATCAAGGCGGCATCAAGCGAGCTCTGAAGCTTTAATCACAATCCACCCGAAATTCGTATTGCTATATGCTCCTTTCGTTCATCCTTTCGTTCACACACAGAGAGCGCAAACCGACCGCCTAGAACAATTGGGTAAAACAACTTAACTCGCTGCCGTGTTAACCACCACCAACTATCTAAGTGAACATTATGCTTTCTATCGATTAGCGACGATTATGTTTGTTGTTTAGCCGGTCGAGCCTAATGTATCAGTAACTTAACCCCTTATGATCGATCGGACCGGATCGGACCGATTCAGCCATTGTACGCCATTGTACCACTGACTAGATGAT

Full Affymetrix probeset data:

Annotations for 1641118_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720