FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641119_at:

>probe:Drosophila_2:1641119_at:318:271; Interrogation_Position=103; Antisense; CATCGCGACCTGCAGATTTACGTGG
>probe:Drosophila_2:1641119_at:218:617; Interrogation_Position=113; Antisense; TGCAGATTTACGTGGGCGCCTTCAC
>probe:Drosophila_2:1641119_at:417:275; Interrogation_Position=132; Antisense; CTTCACGTACATGCGCAACATCAAG
>probe:Drosophila_2:1641119_at:366:31; Interrogation_Position=151; Antisense; ATCAAGTTGCACTGGGACCTGGCCA
>probe:Drosophila_2:1641119_at:38:203; Interrogation_Position=175; Antisense; AACCTGCAGGCGAAGAGCGTGCTCT
>probe:Drosophila_2:1641119_at:572:121; Interrogation_Position=190; Antisense; AGCGTGCTCTCCGACGAGCTGGGAA
>probe:Drosophila_2:1641119_at:556:533; Interrogation_Position=348; Antisense; GGTGGTCACCTACAAGATACTGCCG
>probe:Drosophila_2:1641119_at:37:29; Interrogation_Position=364; Antisense; ATACTGCCGCGCAAGCTGATGGAGA
>probe:Drosophila_2:1641119_at:574:499; Interrogation_Position=392; Antisense; GTCTGCAGCAGTTCAACTCGACGTT
>probe:Drosophila_2:1641119_at:695:129; Interrogation_Position=407; Antisense; ACTCGACGTTGGTGCCACTCGTGGA
>probe:Drosophila_2:1641119_at:138:137; Interrogation_Position=488; Antisense; ACGACCTGATGGTCCTGGAGCAGCA
>probe:Drosophila_2:1641119_at:34:511; Interrogation_Position=538; Antisense; GTGCAGTATCTCAAGAGTATCCGCA
>probe:Drosophila_2:1641119_at:690:683; Interrogation_Position=555; Antisense; TATCCGCAAGATACTCGCGAACCAG
>probe:Drosophila_2:1641119_at:254:493; Interrogation_Position=581; Antisense; GTAAGAGTCTGTGCAAGGCGACCAC

Paste this into a BLAST search page for me
CATCGCGACCTGCAGATTTACGTGGTGCAGATTTACGTGGGCGCCTTCACCTTCACGTACATGCGCAACATCAAGATCAAGTTGCACTGGGACCTGGCCAAACCTGCAGGCGAAGAGCGTGCTCTAGCGTGCTCTCCGACGAGCTGGGAAGGTGGTCACCTACAAGATACTGCCGATACTGCCGCGCAAGCTGATGGAGAGTCTGCAGCAGTTCAACTCGACGTTACTCGACGTTGGTGCCACTCGTGGAACGACCTGATGGTCCTGGAGCAGCAGTGCAGTATCTCAAGAGTATCCGCATATCCGCAAGATACTCGCGAACCAGGTAAGAGTCTGTGCAAGGCGACCAC

Full Affymetrix probeset data:

Annotations for 1641119_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720