Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641120_at:

>probe:Drosophila_2:1641120_at:612:487; Interrogation_Position=2434; Antisense; GTACCTATGCCTACGAGATACCGAA
>probe:Drosophila_2:1641120_at:130:109; Interrogation_Position=2458; Antisense; AGAAGTCGGCGGTAGCCATATATAT
>probe:Drosophila_2:1641120_at:403:439; Interrogation_Position=2526; Antisense; GATAATCGGGTTTGGCTTTACTCCT
>probe:Drosophila_2:1641120_at:536:697; Interrogation_Position=2542; Antisense; TTTACTCCTGTCTTTGATTCTGCTA
>probe:Drosophila_2:1641120_at:369:723; Interrogation_Position=2555; Antisense; TTGATTCTGCTACAATACCTGAGGA
>probe:Drosophila_2:1641120_at:184:565; Interrogation_Position=2577; Antisense; GGAATATCGCCATAACATGCTGACA
>probe:Drosophila_2:1641120_at:21:183; Interrogation_Position=2606; Antisense; AACACTGTACTGTACGTACTACGTA
>probe:Drosophila_2:1641120_at:653:101; Interrogation_Position=2701; Antisense; AGAGCTGATCAATAAACGTGCCAAT
>probe:Drosophila_2:1641120_at:382:391; Interrogation_Position=2740; Antisense; GAAACTGTTTGATTGCTCGCTAAAT
>probe:Drosophila_2:1641120_at:297:357; Interrogation_Position=2799; Antisense; GCAAAGTTTTGACGAGGACCTGATT
>probe:Drosophila_2:1641120_at:253:555; Interrogation_Position=2814; Antisense; GGACCTGATTTCGAAAGCCGACCTT
>probe:Drosophila_2:1641120_at:443:125; Interrogation_Position=2829; Antisense; AGCCGACCTTGAAGCATATACACAT
>probe:Drosophila_2:1641120_at:119:149; Interrogation_Position=2887; Antisense; ACTTAAAGCCAGTGTCTTACATGAA
>probe:Drosophila_2:1641120_at:253:245; Interrogation_Position=2918; Antisense; AATTTTCGTTGAGTCCATGTTAAGT

Paste this into a BLAST search page for me
GTACCTATGCCTACGAGATACCGAAAGAAGTCGGCGGTAGCCATATATATGATAATCGGGTTTGGCTTTACTCCTTTTACTCCTGTCTTTGATTCTGCTATTGATTCTGCTACAATACCTGAGGAGGAATATCGCCATAACATGCTGACAAACACTGTACTGTACGTACTACGTAAGAGCTGATCAATAAACGTGCCAATGAAACTGTTTGATTGCTCGCTAAATGCAAAGTTTTGACGAGGACCTGATTGGACCTGATTTCGAAAGCCGACCTTAGCCGACCTTGAAGCATATACACATACTTAAAGCCAGTGTCTTACATGAAAATTTTCGTTGAGTCCATGTTAAGT

Full Affymetrix probeset data:

Annotations for 1641120_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime