FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641124_at:

>probe:Drosophila_2:1641124_at:54:373; Interrogation_Position=118; Antisense; GAAGTATTTAGACGGCCTGCTGCAA
>probe:Drosophila_2:1641124_at:224:495; Interrogation_Position=146; Antisense; GTCAGCGGGCTGTACGTTATTCAGA
>probe:Drosophila_2:1641124_at:723:711; Interrogation_Position=165; Antisense; TTCAGATTACGGATCGCGACGGAGT
>probe:Drosophila_2:1641124_at:341:185; Interrogation_Position=302; Antisense; AACAAGACCATCATCTCCATGTACT
>probe:Drosophila_2:1641124_at:398:59; Interrogation_Position=320; Antisense; ATGTACTCCAATTACCAGGTGGTCC
>probe:Drosophila_2:1641124_at:37:591; Interrogation_Position=339; Antisense; TGGTCCAGATGAACAAGCTGCCGCT
>probe:Drosophila_2:1641124_at:87:43; Interrogation_Position=365; Antisense; ATCCTGACCTTTGTGGGCGCGGAGA
>probe:Drosophila_2:1641124_at:591:551; Interrogation_Position=385; Antisense; GGAGAACTGTAACACGGGACACATT
>probe:Drosophila_2:1641124_at:534:527; Interrogation_Position=400; Antisense; GGGACACATTCTCGCACTGGAGCAC
>probe:Drosophila_2:1641124_at:25:345; Interrogation_Position=421; Antisense; GCACCAGGTCGATGGCTATTTGGAG
>probe:Drosophila_2:1641124_at:398:179; Interrogation_Position=452; Antisense; AAACAGGCTGTCACCGAGGCCTAAA
>probe:Drosophila_2:1641124_at:321:427; Interrogation_Position=467; Antisense; GAGGCCTAAAGTTAGTCTACCTTGT
>probe:Drosophila_2:1641124_at:625:687; Interrogation_Position=55; Antisense; TATTATTGCCATACCTTCTCTAGTC
>probe:Drosophila_2:1641124_at:152:715; Interrogation_Position=70; Antisense; TTCTCTAGTCTTTCGCTTTAACAAA

Paste this into a BLAST search page for me
GAAGTATTTAGACGGCCTGCTGCAAGTCAGCGGGCTGTACGTTATTCAGATTCAGATTACGGATCGCGACGGAGTAACAAGACCATCATCTCCATGTACTATGTACTCCAATTACCAGGTGGTCCTGGTCCAGATGAACAAGCTGCCGCTATCCTGACCTTTGTGGGCGCGGAGAGGAGAACTGTAACACGGGACACATTGGGACACATTCTCGCACTGGAGCACGCACCAGGTCGATGGCTATTTGGAGAAACAGGCTGTCACCGAGGCCTAAAGAGGCCTAAAGTTAGTCTACCTTGTTATTATTGCCATACCTTCTCTAGTCTTCTCTAGTCTTTCGCTTTAACAAA

Full Affymetrix probeset data:

Annotations for 1641124_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720