Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641125_at:

>probe:Drosophila_2:1641125_at:502:533; Interrogation_Position=1055; Antisense; GGTGCTCCCATCGATGTTGTTAAGA
>probe:Drosophila_2:1641125_at:76:467; Interrogation_Position=1070; Antisense; GTTGTTAAGAACGAGCACCCAGACT
>probe:Drosophila_2:1641125_at:430:99; Interrogation_Position=1185; Antisense; AGAGTGCCACTCTAGTTGTACACTA
>probe:Drosophila_2:1641125_at:342:535; Interrogation_Position=761; Antisense; GGTGCCCAGGAAGCCATGGACTCTC
>probe:Drosophila_2:1641125_at:59:67; Interrogation_Position=776; Antisense; ATGGACTCTCATCCTGGGCAGTACA
>probe:Drosophila_2:1641125_at:591:523; Interrogation_Position=791; Antisense; GGGCAGTACATTTTAACCTTGAAGA
>probe:Drosophila_2:1641125_at:723:391; Interrogation_Position=820; Antisense; GAAAGGCTTCGTGCGAATGGCCATT
>probe:Drosophila_2:1641125_at:671:107; Interrogation_Position=845; Antisense; AGAACGGGCTCATCGATTGTTCCTT
>probe:Drosophila_2:1641125_at:532:1; Interrogation_Position=860; Antisense; ATTGTTCCTTCATTTTCCTTTGGAG
>probe:Drosophila_2:1641125_at:175:521; Interrogation_Position=887; Antisense; GTGGACATTTTCGATCAGGTGGCAA
>probe:Drosophila_2:1641125_at:78:1; Interrogation_Position=929; Antisense; CTCCGACGGTTTCAGGACTTTGTCA
>probe:Drosophila_2:1641125_at:619:403; Interrogation_Position=944; Antisense; GACTTTGTCAAGAAGCTCACCGGAG
>probe:Drosophila_2:1641125_at:598:431; Interrogation_Position=966; Antisense; GAGTCTCTCCGCTGATTCCTGTGGG
>probe:Drosophila_2:1641125_at:239:541; Interrogation_Position=995; Antisense; GGATTCTTCAACTACACCTTTGGCT

Paste this into a BLAST search page for me
GGTGCTCCCATCGATGTTGTTAAGAGTTGTTAAGAACGAGCACCCAGACTAGAGTGCCACTCTAGTTGTACACTAGGTGCCCAGGAAGCCATGGACTCTCATGGACTCTCATCCTGGGCAGTACAGGGCAGTACATTTTAACCTTGAAGAGAAAGGCTTCGTGCGAATGGCCATTAGAACGGGCTCATCGATTGTTCCTTATTGTTCCTTCATTTTCCTTTGGAGGTGGACATTTTCGATCAGGTGGCAACTCCGACGGTTTCAGGACTTTGTCAGACTTTGTCAAGAAGCTCACCGGAGGAGTCTCTCCGCTGATTCCTGTGGGGGATTCTTCAACTACACCTTTGGCT

Full Affymetrix probeset data:

Annotations for 1641125_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime