FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641126_at:

>probe:Drosophila_2:1641126_at:64:299; Interrogation_Position=1004; Antisense; CGCCGTACCGAGTGGACAACGTGGT
>probe:Drosophila_2:1641126_at:719:159; Interrogation_Position=1019; Antisense; ACAACGTGGTGTCCAGCTCGAACAA
>probe:Drosophila_2:1641126_at:589:357; Interrogation_Position=1055; Antisense; GCAACTACATCAAGCGCATCATCAA
>probe:Drosophila_2:1641126_at:715:179; Interrogation_Position=1078; Antisense; AAACAGTTCTTCAACACGAGGCCAT
>probe:Drosophila_2:1641126_at:645:37; Interrogation_Position=1167; Antisense; ATCTCTTGCATCTGGATCGCCGGTT
>probe:Drosophila_2:1641126_at:448:213; Interrogation_Position=679; Antisense; AAGATGCTTATCCTGAAATGCCGAT
>probe:Drosophila_2:1641126_at:50:613; Interrogation_Position=692; Antisense; TGAAATGCCGATCCAAGTCCACGGA
>probe:Drosophila_2:1641126_at:644:75; Interrogation_Position=716; Antisense; AGGAGCTGAGTGATATCTACGCGAT
>probe:Drosophila_2:1641126_at:450:21; Interrogation_Position=728; Antisense; ATATCTACGCGATGAACCTCTCGCT
>probe:Drosophila_2:1641126_at:11:353; Interrogation_Position=755; Antisense; GCAGCAACGTGCAGGTGATCAAGGA
>probe:Drosophila_2:1641126_at:267:197; Interrogation_Position=784; Antisense; AACGGCAACTTTGATGATCCGCAAA
>probe:Drosophila_2:1641126_at:212:53; Interrogation_Position=884; Antisense; ATGCTGATGTCAGTCCAGAGGCGCA
>probe:Drosophila_2:1641126_at:417:531; Interrogation_Position=940; Antisense; GGGTACAATGAAGTCTCCTGGCAAG
>probe:Drosophila_2:1641126_at:682:629; Interrogation_Position=980; Antisense; TCCTAAATGAAGTCACCATCTCGCC

Paste this into a BLAST search page for me
CGCCGTACCGAGTGGACAACGTGGTACAACGTGGTGTCCAGCTCGAACAAGCAACTACATCAAGCGCATCATCAAAAACAGTTCTTCAACACGAGGCCATATCTCTTGCATCTGGATCGCCGGTTAAGATGCTTATCCTGAAATGCCGATTGAAATGCCGATCCAAGTCCACGGAAGGAGCTGAGTGATATCTACGCGATATATCTACGCGATGAACCTCTCGCTGCAGCAACGTGCAGGTGATCAAGGAAACGGCAACTTTGATGATCCGCAAAATGCTGATGTCAGTCCAGAGGCGCAGGGTACAATGAAGTCTCCTGGCAAGTCCTAAATGAAGTCACCATCTCGCC

Full Affymetrix probeset data:

Annotations for 1641126_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720