FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641127_at:

>probe:Drosophila_2:1641127_at:183:567; Interrogation_Position=116; Antisense; GGCACAATCTGTTCCGCAATCACGA
>probe:Drosophila_2:1641127_at:551:361; Interrogation_Position=131; Antisense; GCAATCACGACGATATGGACCTGTA
>probe:Drosophila_2:1641127_at:426:253; Interrogation_Position=141; Antisense; CGATATGGACCTGTACGAGGGACCC
>probe:Drosophila_2:1641127_at:355:473; Interrogation_Position=166; Antisense; GTTAAACCGGATCCGTTTGGCATAT
>probe:Drosophila_2:1641127_at:390:691; Interrogation_Position=181; Antisense; TTTGGCATATCGACAGCCGCCGGAG
>probe:Drosophila_2:1641127_at:499:315; Interrogation_Position=242; Antisense; GCCTTCTGCTCGTCGATGAGCAATT
>probe:Drosophila_2:1641127_at:707:13; Interrogation_Position=25; Antisense; ATTAAGAATCACTTTCGGGCCCATC
>probe:Drosophila_2:1641127_at:172:315; Interrogation_Position=287; Antisense; GCCTGAACGGCTCGGCCTATTTGAA
>probe:Drosophila_2:1641127_at:656:571; Interrogation_Position=295; Antisense; GGCTCGGCCTATTTGAACGGCATAT
>probe:Drosophila_2:1641127_at:515:613; Interrogation_Position=308; Antisense; TGAACGGCATATTGGGCGGTAAGTA
>probe:Drosophila_2:1641127_at:581:577; Interrogation_Position=42; Antisense; GGCCCATCAACTCTCGATTTGGCTG
>probe:Drosophila_2:1641127_at:542:689; Interrogation_Position=59; Antisense; TTTGGCTGCGCCTGATACCGGAGCT
>probe:Drosophila_2:1641127_at:636:25; Interrogation_Position=73; Antisense; ATACCGGAGCTTCATCGCGCCGGGA
>probe:Drosophila_2:1641127_at:557:547; Interrogation_Position=99; Antisense; GGAGGATGTGATAGCCCGGCACAAT

Paste this into a BLAST search page for me
GGCACAATCTGTTCCGCAATCACGAGCAATCACGACGATATGGACCTGTACGATATGGACCTGTACGAGGGACCCGTTAAACCGGATCCGTTTGGCATATTTTGGCATATCGACAGCCGCCGGAGGCCTTCTGCTCGTCGATGAGCAATTATTAAGAATCACTTTCGGGCCCATCGCCTGAACGGCTCGGCCTATTTGAAGGCTCGGCCTATTTGAACGGCATATTGAACGGCATATTGGGCGGTAAGTAGGCCCATCAACTCTCGATTTGGCTGTTTGGCTGCGCCTGATACCGGAGCTATACCGGAGCTTCATCGCGCCGGGAGGAGGATGTGATAGCCCGGCACAAT

Full Affymetrix probeset data:

Annotations for 1641127_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720