Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641128_a_at:

>probe:Drosophila_2:1641128_a_at:441:245; Interrogation_Position=1302; Antisense; AATTATACTCAATTGCCAGGCAGAT
>probe:Drosophila_2:1641128_a_at:437:247; Interrogation_Position=1312; Antisense; AATTGCCAGGCAGATGGCACGCCCA
>probe:Drosophila_2:1641128_a_at:308:99; Interrogation_Position=1323; Antisense; AGATGGCACGCCCACGCCGGAAATA
>probe:Drosophila_2:1641128_a_at:56:261; Interrogation_Position=1335; Antisense; CACGCCGGAAATACTCTGGTACAAG
>probe:Drosophila_2:1641128_a_at:633:667; Interrogation_Position=1346; Antisense; TACTCTGGTACAAGGATGCCAATCC
>probe:Drosophila_2:1641128_a_at:557:139; Interrogation_Position=1387; Antisense; ACGGTGGGCATCTTCAACGACGGCA
>probe:Drosophila_2:1641128_a_at:170:651; Interrogation_Position=1400; Antisense; TCAACGACGGCACCGAGTTGCGGAT
>probe:Drosophila_2:1641128_a_at:160:429; Interrogation_Position=1414; Antisense; GAGTTGCGGATCTCTACCATTCGGC
>probe:Drosophila_2:1641128_a_at:661:673; Interrogation_Position=1428; Antisense; TACCATTCGGCACGAGGACATCGGA
>probe:Drosophila_2:1641128_a_at:585:557; Interrogation_Position=1443; Antisense; GGACATCGGAGAGTACACTTGCATT
>probe:Drosophila_2:1641128_a_at:41:427; Interrogation_Position=1451; Antisense; GAGAGTACACTTGCATTGCACGCAA
>probe:Drosophila_2:1641128_a_at:648:273; Interrogation_Position=1464; Antisense; CATTGCACGCAATGGTGAGGGACAA
>probe:Drosophila_2:1641128_a_at:179:513; Interrogation_Position=1478; Antisense; GTGAGGGACAAGTCTCCCATACGGC
>probe:Drosophila_2:1641128_a_at:552:265; Interrogation_Position=1495; Antisense; CATACGGCCCGTGTTATAATCGCGG

Paste this into a BLAST search page for me
AATTATACTCAATTGCCAGGCAGATAATTGCCAGGCAGATGGCACGCCCAAGATGGCACGCCCACGCCGGAAATACACGCCGGAAATACTCTGGTACAAGTACTCTGGTACAAGGATGCCAATCCACGGTGGGCATCTTCAACGACGGCATCAACGACGGCACCGAGTTGCGGATGAGTTGCGGATCTCTACCATTCGGCTACCATTCGGCACGAGGACATCGGAGGACATCGGAGAGTACACTTGCATTGAGAGTACACTTGCATTGCACGCAACATTGCACGCAATGGTGAGGGACAAGTGAGGGACAAGTCTCCCATACGGCCATACGGCCCGTGTTATAATCGCGG

Full Affymetrix probeset data:

Annotations for 1641128_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime