FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641129_at:

>probe:Drosophila_2:1641129_at:433:19; Interrogation_Position=1225; Antisense; ATTTGCATTCTGGACCATCCGGTGG
>probe:Drosophila_2:1641129_at:695:223; Interrogation_Position=1258; Antisense; AAGGATGGTCTCTCCACGCAGATTA
>probe:Drosophila_2:1641129_at:254:9; Interrogation_Position=1285; Antisense; ATTCCACAAAAGCAGGTCGGCCGCA
>probe:Drosophila_2:1641129_at:407:151; Interrogation_Position=1316; Antisense; ACATCTATGTGTCGCTTGTGAGCTC
>probe:Drosophila_2:1641129_at:165:205; Interrogation_Position=1423; Antisense; AAGCCTGGCTTGGACTTGCTGGAGC
>probe:Drosophila_2:1641129_at:727:721; Interrogation_Position=1438; Antisense; TTGCTGGAGCCGATCGCACAAAAGT
>probe:Drosophila_2:1641129_at:585:441; Interrogation_Position=1498; Antisense; GATGGATCCGAGTCTCAAATCTTTA
>probe:Drosophila_2:1641129_at:346:711; Interrogation_Position=1524; Antisense; TTCGGAGTCTTACGATGCGACCACG
>probe:Drosophila_2:1641129_at:667:293; Interrogation_Position=1541; Antisense; CGACCACGCACTTTGAGACTACTTG
>probe:Drosophila_2:1641129_at:390:403; Interrogation_Position=1557; Antisense; GACTACTTGCCTGGATGTGTTGAAC
>probe:Drosophila_2:1641129_at:113:103; Interrogation_Position=1604; Antisense; AGACGTTCGACTTCTCCAAGATCAA
>probe:Drosophila_2:1641129_at:55:369; Interrogation_Position=1665; Antisense; GAAGGCCTCATCTGGTTATGGTGCA
>probe:Drosophila_2:1641129_at:550:705; Interrogation_Position=1680; Antisense; TTATGGTGCATTTGGACAGCTCAAC
>probe:Drosophila_2:1641129_at:373:179; Interrogation_Position=1714; Antisense; AAACATCGTAGATCGTCTCAGCGTC

Paste this into a BLAST search page for me
ATTTGCATTCTGGACCATCCGGTGGAAGGATGGTCTCTCCACGCAGATTAATTCCACAAAAGCAGGTCGGCCGCAACATCTATGTGTCGCTTGTGAGCTCAAGCCTGGCTTGGACTTGCTGGAGCTTGCTGGAGCCGATCGCACAAAAGTGATGGATCCGAGTCTCAAATCTTTATTCGGAGTCTTACGATGCGACCACGCGACCACGCACTTTGAGACTACTTGGACTACTTGCCTGGATGTGTTGAACAGACGTTCGACTTCTCCAAGATCAAGAAGGCCTCATCTGGTTATGGTGCATTATGGTGCATTTGGACAGCTCAACAAACATCGTAGATCGTCTCAGCGTC

Full Affymetrix probeset data:

Annotations for 1641129_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720