Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641130_at:

>probe:Drosophila_2:1641130_at:677:369; Interrogation_Position=4347; Antisense; GAATGTGTCCACGATCACTGGCACG
>probe:Drosophila_2:1641130_at:295:583; Interrogation_Position=4365; Antisense; TGGCACGTTGAAGTCAGAGTTTCCT
>probe:Drosophila_2:1641130_at:273:101; Interrogation_Position=4380; Antisense; AGAGTTTCCTGGTCTGGAACTGCGC
>probe:Drosophila_2:1641130_at:674:383; Interrogation_Position=4396; Antisense; GAACTGCGCGAGAGCCATGCCGGCA
>probe:Drosophila_2:1641130_at:297:147; Interrogation_Position=4422; Antisense; ACTCACCTACTTTGTTAGCACGCAG
>probe:Drosophila_2:1641130_at:159:517; Interrogation_Position=4453; Antisense; GTGGTCCTTTGGTCAAGTGTTTTCA
>probe:Drosophila_2:1641130_at:179:711; Interrogation_Position=4507; Antisense; TTAAGCGCTCTCGTGGCCGACTATT
>probe:Drosophila_2:1641130_at:594:403; Interrogation_Position=4525; Antisense; GACTATTCGGTGAACGAGTGCACAC
>probe:Drosophila_2:1641130_at:29:433; Interrogation_Position=4540; Antisense; GAGTGCACACTCGAGGATATTTTCC
>probe:Drosophila_2:1641130_at:419:395; Interrogation_Position=4584; Antisense; GAAATCACAATCGACGTCACGTCAA
>probe:Drosophila_2:1641130_at:167:369; Interrogation_Position=4630; Antisense; GAATGCAGCTACGTTTAGGCCAGAT
>probe:Drosophila_2:1641130_at:411:375; Interrogation_Position=4689; Antisense; GAAGACGGGCGTCGTACATTTCATT
>probe:Drosophila_2:1641130_at:241:499; Interrogation_Position=4699; Antisense; GTCGTACATTTCATTATTTCCCTCA
>probe:Drosophila_2:1641130_at:338:705; Interrogation_Position=4736; Antisense; TTATGAATCTCTATCCGGTGGGAAT

Paste this into a BLAST search page for me
GAATGTGTCCACGATCACTGGCACGTGGCACGTTGAAGTCAGAGTTTCCTAGAGTTTCCTGGTCTGGAACTGCGCGAACTGCGCGAGAGCCATGCCGGCAACTCACCTACTTTGTTAGCACGCAGGTGGTCCTTTGGTCAAGTGTTTTCATTAAGCGCTCTCGTGGCCGACTATTGACTATTCGGTGAACGAGTGCACACGAGTGCACACTCGAGGATATTTTCCGAAATCACAATCGACGTCACGTCAAGAATGCAGCTACGTTTAGGCCAGATGAAGACGGGCGTCGTACATTTCATTGTCGTACATTTCATTATTTCCCTCATTATGAATCTCTATCCGGTGGGAAT

Full Affymetrix probeset data:

Annotations for 1641130_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime